952 resultados para DNA sequence
Resumo:
Ancient DNA (aDNA) research has long depended on the power of PCR to amplify trace amounts of surviving genetic material from preserved specimens. While PCR permits specific loci to be targeted and amplified, in many ways it can be intrinsically unsuited to damaged and degraded aDNA templates. PCR amplification of aDNA can produce highly-skewed distributions with significant contributions from miscoding lesion damage and non-authentic sequence artefacts. As traditional PCR-based approaches have been unable to fully resolve the molecular nature of aDNA damage over many years, we have developed a novel single primer extension (SPEX)-based approach to generate more accurate sequence information. SPEX targets selected template strands at defined loci and can generate a quantifiable redundancy of coverage; providing new insights into the molecular nature of aDNA damage and fragmentation. SPEX sequence data reveals inherent limitations in both traditional and metagenomic PCR-based approaches to aDNA, which can make current damage analyses and correct genotyping of ancient specimens problematic. In contrast to previous aDNA studies, SPEX provides strong quantitative evidence that C U-type base modifications are the sole cause of authentic endogenous damage-derived miscoding lesions. This new approach could allow ancient specimens to be genotyped with unprecedented accuracy.
Resumo:
Recombination is thought to occur only rarely in animal mitochondrial DNA ( mtDNA). However, detection of mtDNA recombination requires that cells become heteroplasmic through mutation, intramolecular recombination or ' leakage' of paternal mtDNA. Interspecific hybridization increases the probability of detecting mtDNA recombinants due to higher levels of sequence divergence and potentially higher levels of paternal leakage. During a study of historical variation in Atlantic salmon ( Salmo salar) mtDNA, an individual with a recombinant haplotype containing sequence from both Atlantic salmon and brown trout ( Salmo trutta) was detected. The individual was not an F1 hybrid but it did have an unusual nuclear genotype which suggested that it was a later-generation backcross. No other similar recombinant haplotype was found from the same population or three neighbouring Atlantic salmon populations in 717 individuals collected during 1948 - 2002. Interspecific recombination may increase mtDNA variability within species and can have implications for phylogenetic studies.
Resumo:
About 5.5% of all UK hemophilia B patients have the base substitution IVS 5+13 A-->G as the only change in their factor (F)IX gene (F9). This generates a novel donor splice site which fits the consensus better than the normal intron 5 donor splice. Use of the novel splice site should result in a missense mutation followed by the abnormal addition of four amino acids to the patients' FIX. In order to explain the prevalence of this mutation, its genealogical history is examined. Analysis of restriction fragment length polymorphism in the 21 reference UK individuals (from different families) with the above mutation showed identical haplotypes in 19 while two differed from the rest and from each other. In order to investigate the history of the mutation and to verify that it had occurred independently more than once, the sequence variation in 1.5-kb segments scattered over a 13-Mb region including F9 was examined in 18 patients and 15 controls. This variation was then analyzed with a recently developed Bayesian approach that reconstructs the genealogy of the gene investigated while providing evidence of independent mutations that contribute disconnected branches to the genealogical tree. The method also provides minimum estimates of the age of the mutation inherited by the members of coherent trees. This revealed that 17 or 18 mutant genes descend from a founder who probably lived 450 years ago, while one patient carries an independent mutation. The independent recurrence of the IVS5+13 A-->G mutation strongly supports the conclusion that it is the cause of these patients' mild hemophilia.
Resumo:
The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The phylogenetics of Sternbergia (Amaryllidaceae) were studied using DNA sequences of the plastid ndhF and matK genes and nuclear internal transcribed spacer (ITS) ribosomal region for 38, 37 and 32 ingroup and outgroup accessions, respectively. All members of Sternbergia were represented by at least one accession, except S. minoica and S. schubertii, with additional taxa from Narcissus and Pancratium serving as principal outgroups. Sternbergia was resolved and supported as sister to Narcissus and composed of two primary subclades: S. colchiciflora sister to S. vernalis, S. candida and S. clusiana, with this clade in turn sister to S. lutea and its allies in both Bayesian and bootstrap analyses. A clear relationship between the two vernal flowering members of the genus was recovered, supporting the hypothesis of a single origin of vernal flowering in Sternbergia. However, in the S. lutea complex, the DNA markers examined did not offer sufficient resolving power to separate taxa, providing some support for the idea that S. sicula and S. greuteriana are conspecific with S. lutea
Resumo:
d(ACGTACGT), C78H84N30O32P7.20H2O, Mr (DNA) = 2170, tetragonal, P43212 (No 96), a = 42.845 (1), b = 42.845(1), c = 24.804 (1) Å, V = 45532.5 (2) Å3, z = 8,(MoK) = 0.71069 Å,µ(MoK) = 0.10 mm-1, T = 295 K, R = 0.18 for 1994 unique reflections between 5.0 and 1.9 Å resolution. The self-complementary octanucleotide d(ACGTACGT)2 has been crystallized and its structure determined to a resolution of 1.9 Å. The asymmetric unit consists of a single strand of octamer with 20 water molecules. It is only the second example of an octanucleotide having terminal A·T base pairs whose structure has been determined by X-ray crystallography. The sequence adopts the modified A-type conformation found for all octanucleotide duplexes studied to date with the helix bent by approximately 15° and an average tilt angle of 0°. Unusually the data collection was carried out using a 3 kW molybdenum sealed-tube source. The conformational details are discussed in comparison with other closely related sequences.
Resumo:
An apple rootstock progeny raised from the cross between the very dwarfing ‘M.27’ and the more vigorous ‘M.116’ (‘M.M.106’ × ‘M.27’) was used for the construction of a linkage map comprising a total of 324 loci: 252 previously mapped SSRs, 71 newly characterised or previously unmapped SSR loci (including 36 amplified by 33 out of the 35 novel markers reported here), and the self-incompatibility locus. The map spanned the 17 linkage groups (LG) expected for apple covering a genetic distance of 1,229.5 cM, an estimated 91% of the Malus genome. Linkage groups were well populated and, although marker density ranged from 2.3 to 6.2 cM/SSR, just 15 gaps of more than 15 cM were observed. Moreover, only 17.5% of markers displayed segregation distortion and, unsurprisingly in a semi-compatible backcross, distortion was particularly pronounced surrounding the self-incompatibility locus (S) at the bottom of LG17. DNA sequences of 273 SSR markers and the S locus, representing a total of 314 loci in this investigation, were used to anchor to the ‘Golden Delicious’ genome sequence. More than 260 of these loci were located on the expected pseudo-chromosome on the ‘Golden Delicious’ genome or on its homeologous pseudo-chromosome. In total, 282.4 Mbp of sequence from 142 genome sequence scaffolds of the Malus genome were anchored to the ‘M.27’ × ‘M.116’ map, providing an interface between the marker data and the underlying genome sequence. This will be exploited for the identification of genes responsible for traits of agronomic importance such as dwarfing and water use efficiency.
Resumo:
Physiological and yield traits such as stomatal conductance (mmol m-2s-1), Leaf relative water content (RWC %) and grain yield per plant were studied in a separate experiment. Results revealed that five out of sixteen cultivars viz. Anmol, Moomal, Sarsabz, Bhitai and Pavan, appeared to be relatively more drought tolerant. Based on morphophysiological results, studies were continued to look at these cultivars for drought tolerance at molecular level. Initially, four well recognized primers for dehydrin genes (DHNs) responsible for drought induction in T. durum L., T. aestivum L. and O. sativa L. were used for profiling gene sequence of sixteen wheat cultivars. The primers amplified the DHN genes variably like Primer WDHN13 (T. aestivum L.) amplified the DHN gene in only seven cultivars whereas primer TdDHN15 (T. durum L.) amplified all the sixteen cultivars with even different DNA banding patterns some showing second weaker DNA bands. Third primer TdDHN16 (T. durum L.) has shown entirely different PCR amplification prototype, specially showing two strong DNA bands while fourth primer RAB16C (O. sativa L.) failed to amplify DHN gene in any of the cultivars. Examination of DNA sequences revealed several interesting features. First, it identified the two exon/one intron structure of this gene (complete sequences were not shown), a feature not previously described in the two database cDNA sequences available from T. aestivum L. (gi|21850). Secondly, the analysis identified several single nucleotide polymorphisms (SNPs), positions in gene sequence. Although complete gene sequence was not obtained for all the cultivars, yet there were a total of 38 variable positions in exonic (coding region) sequence, from a total gene length of 453 nucleotides. Matrix of SNP shows these 37 positions with individual sequence at positions given for each of the 14 cultivars (sequence of two cultivars was not obtained) included in this analysis. It demonstrated a considerable diversity for this gene with only three cultivars i.e. TJ-83, Marvi and TD-1 being similar to the consensus sequence. All other cultivars showed a unique combination of SNPs. In order to prove a functional link between these polymorphisms and drought tolerance in wheat, it would be necessary to conduct a more detailed study involving directed mutation of this gene and DHN gene expression.
Resumo:
Antimicrobial drug resistance is a global challenge for the 21st century with the emergence of resistant bacterial strains worldwide. Transferable resistance to beta-lactam antimicrobial drugs, mediated by production of extended-spectrum beta-lactamases (ESBLs), is of particular concern. In 2004, an ESBL-carrying IncK plasmid (pCT) was isolated from cattle in the United Kingdom. The sequence was a 93,629-bp plasmid encoding a single antimicrobial drug resistance gene, bla(CTX-M-14). From this information, PCRs identifying novel features of pCT were designed and applied to isolates from several countries, showing that the plasmid has disseminated worldwide in bacteria from humans and animals. Complete DNA sequences can be used as a platform to develop rapid epidemiologic tools to identify and trace the spread of plasmids in clinically relevant pathogens, thus facilitating a better understanding of their distribution and ability to transfer between bacteria of humans and animals.
Resumo:
Mitochondria and Wolbachia are maternally inherited genomes that exhibit strong linkage disequilibrium in many organisms. We surveyed Wolbachia infections in 187 specimens of the fig wasp species, Ceratosolen solmsi, and found an infection prevalence of 89.3%. DNA sequencing of 20 individuals each from Wolbachia-infected and -uninfected subpopulations revealed extreme mtDNA divergence (up to 9.2% and 15.3% in CO1 and cytochrome b, respectively) between infected and uninfected wasps. Further, mtDNA diversity was significantly reduced within the infected group. Our sequencing of a large part of the mitochondrial genome from both Wolbachia-infected and -uninfected individuals revealed that high sequence divergence is common throughout the mitochondrial genome. These patterns suggest a partial selective sweep of mitochondria subsequent to the introduction of Wolbachia into C. solsmi, by hybrid introgression from a related species.
Resumo:
The pefA gene which encoded the serotype associated plasmid (SAP) mediated fimbrial major subunit antigen of Salmonella enterica serotype Typhimurium shared genetic identity with 128 of 706 salmonella isolates as demonstrated by dot (colony) hybridization. Seventy-seven of 113 isolates of Typhimurium and individual isolates of serotypes Bovis-morbificans, Cholerae-suis and Enteritidis phage type 9b hybridized pefA strongly, whereas 48 isolates of Enteritidis hybridized pefA weakly and one Enteritidis isolate of phage type 14b failed to hybridize. Individual isolates of 294 serotypes and 247 individual isolates of serotype Dublin did not hybridize pefA. Southern hybridization of plasmids extracted from Enteritidis demonstrated that the pefA gene probe hybridized strongly an atypical SAP of 80 kb in size harboured by one Enteritidis isolate of phage-type 9b, whereas the typical SAP of 58 kb in size harboured by 48 Enteritidis isolates hybridized weakly. One Enteritidis isolate of phage type 14b which failed to hybridize pefA in dot (colony) hybridization experiments was demonstrated to be plasmid free. A cosmid library of Enteritidis phage type 4 expressed in Escherichia coli K12 was screened by hybridization for the presence of pef sequences. Recombinant clones which were deduced to harbour the entire pef operon elaborated a PEF-like fimbrial structure at the cell surface. The PEF-like fimbrial antigen was purified from one cosmid clone and used in western blot experiments with sera from chickens infected with Enteritidis phage-type 4. Seroconversion to the fimbrial antigen was observed which indicated that the Enteritidis PEF-like fimbrial structure was expressed at some stage during infection. Nucleotide sequence analysis demonstrated that the pefA alleles of Typhimurium and Enteritidis phage-type 4 shared 76% DNA nucleotide and 82% deduced amino acid sequence identity.
Resumo:
The nucleotide sequence of a 3 kb region immediately upstream of the sef operon operon of Salmonella enteritidis was determined. A 1230 base pair insertion sequence which shared sequence identity (> 75%) with members of the IS3 family was revealed. This element, designated IS1230, had almost identical (90% identity) terminal inverted repeats to Escherichia coli IS3 but unlike other IS3-like sequences lacked the two characteristic open reading frames which encode the putative transposase. S. enteritidis possessed only one copy of this insertion sequence although Southern hybridisation analysis of restriction digests of genomic DNA revealed another fragment located in a region different from the sef operon which hybridised weakly which suggested the presence of an IS1230 homologue. The distribution of IS1230 and IS1230-like elements was shown to be widespread amongst salmonellas and the patterns of restriction fragments which hybridised differed significantly between Salmonella serotypes and it is suggested that IS1230 has potential for development as a differential diagnostic tool.
Resumo:
The genome of Salmonella enterica serovar Enteritidis was shown to possess three IS3-like insertion elements, designated IS1230A, B and C, and each was cloned and their respective deoxynucleotide sequences determined. Mutations in elements IS1230A and B resulted in frameshifts in the open reading frames that encoded a putative transposase to be inactive. IS1230C was truncated at nucleotide 774 relative to IS1230B and therefore did not possess the 3' terminal inverted repeat. The three IS1230 derivatives were closely related to each other based on nucleotide sequence similarity. IS1230A was located adjacent to the sef operon encoding SEF14 fimbriae located at minute 97 of the genome of S. Enteritidis. IS1230B was located adjacent to the umuDC operon at minute 42.5 on the genome, itself located near to one terminus of an 815-kb genome inversion of S. Enteritidis relative to S. Typhimurium. IS1230C was located next to attB, the bacteriophage P22 attachment site, and proB, encoding gamma-glutamyl phosphate reductase. A truncated 3' remnant of IS1230, designated IS1230T, was identified in a clinical isolate of S. Typhimurium DT193 strain 2391. This element was located next to attB adjacent to which were bacteriophage P22-like sequences. Southern hybridisation of total genomic DNA from eighteen phage types of S. Enteritidis and eighteen definitive types of S. Typhimurium showed similar, if not identical, restriction fragment profiles in the respective serovars when probed with IS1230A.
Resumo:
Phylogenetic analysis of nrDNA ITS and trnL (UAA) 5′ exon-trnF (GAA) chloroplast DNA sequences from 17 species ofPelargonium sect.Peristera, together with nine putative outgroups, suggests paraphyly for the section and a close relationship between the highly disjunct South African and Australian species of sect.Peristera. Representatives fromPelargonium sectt.Reniformia, Ligularia s. l. andIsopetalum (the St. Helena endemicP. cotyledonis) appear to be nested within thePeristera clade. The close relationship between the South African and AustralianPeristera is interpreted as being caused by long-range dispersal to Australia, probably as recent as the late Pliocene.