996 resultados para DNA conformation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Glioblastoma multiforme (GBM; World Health Organization astrocytoma grade IV) is the most frequent and most malignant primary brain tumor in adults. Despite multimodal therapy, all such tumors practically recur during the course of therapy, causing a median survival of only 14.6 months in patients with newly diagnosed GBM. The present study was aimed at examining the expression of the DNA repair protein AlkB homolog 2 (ALKBH2) in human GBM and determining whether it could promote resistance to temozolomide chemotherapy. METHODS: ALKBH2 expression in GBM cell lines and in human GBM was determined by quantitative real-time PCR (qRT-PCR) and gene expression analysis, respectively. Drug sensitivity was assessed in GBM cells overexpressing ALKBH2 and in cells in which ALKBH2 expression was silenced by small-interfering (si)RNA. ALKBH2 expression following activation of the p53 pathway was examined by western blotting and qRT-PCR. RESULTS: ALKBH2 was abundantly expressed in established GBM cell lines and human GBM, and temozolomide exposure increased cellular ALKBH2 expression levels. Overexpression of ALKBH2 in the U87 and U251 GBM cell lines enhanced resistance to the methylating agents temozolomide and methyl methanesulfonate but not to the nonmethylating agent doxorubicin. Conversely, siRNA-mediated knockdown of ALKBH2 increased sensitivity of GBM cells to temozolomide and methyl methanesulfonate but not to doxorubicin or cisplatin. Nongenotoxic activation of the p53 pathway by the selective murine double minute 2 antagonist nutlin-3 caused a significant decrease in cellular ALKBH2 transcription levels. CONCLUSION: Our findings identify ALKBH2 as a novel mediator of temozolomide resistance in human GBM cells. Furthermore, we place ALKBH2 into a new cellular context by showing its regulation by the p53 pathway.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The estrogen-responsive element (ERE) present in the 5'-flanking region of the Xenopus laevis vitellogenin (vit) gene B1 has been characterized by transient expression analysis of chimeric vit-tk-CAT (chloramphenicol acetyltransferase) gene constructs transfected into the human estrogen-responsive MCF-7 cell line. The vit B1 ERE behaves like an inducible enhancer, since it is able to confer estrogen inducibility to the heterologous HSV thymidine kinase (tk) promoter in a relative position- and orientation-independent manner. In this assay, the minimal B1 ERE is 33 bp long and consists of two 13 bp imperfect palindromic elements both of which are required for the enhancer activity. A third imperfect palindromic element is present further upstream within the 5'-flanking region of the gene but is unable to confer hormone responsiveness by itself. Similarly, neither element forming the B1 ERE can alone confer estrogen inducibility to the tk promoter. However, in combinations of two, all three imperfect palindromes can act cooperatively to form a functional ERE. In contrast a single 13 bp perfect palindromic element, GGTCACTGTGACC, such as the one found upstream of the vit gene A2, is itself sufficient to act as a fully active ERE. Single point mutations within this element abolish estrogen inducibility, while a defined combination of two mutations converts this ERE into a glucocorticoid-responsive element.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Following wider acceptance of 'the thrifty phenotype' hypothesis and the convincing evidence that early-life exposures can influence adult health even decades after the exposure, much interest has been placed on the mechanisms through which early-life exposures become biologically embedded. MATERIALS AND METHODS: In this review, we summarize the current literature regarding biological embedding of early-life experiences. To this end, we conducted a literature search to identify studies investigating early-life exposures in relation to DNA methylation changes. In addition, we summarize the challenges faced in investigations of epigenetic effects, stemming from the peculiarities of this emergent and complex field. A proper systematic review and meta-analyses were not feasible given the nature of the evidence. RESULTS: We identified seven studies on early-life socio-economic circumstances, 10 studies on childhood obesity and six studies on early-life nutrition all relating to DNA methylation changes that met the stipulated inclusion criteria. The pool of evidence gathered, albeit small, favours a role of epigenetics and DNA methylation in biological embedding, but replication of findings, multiple comparison corrections, publication bias and causality are concerns remaining to be addressed in future investigations. CONCLUSIONS: Based on these results, we hypothesize that epigenetics, in particular DNA methylation, is a plausible mechanism through which early-life exposures are biologically embedded. This review describes the current status of the field and acts as a stepping stone for future, better designed investigations on how early-life exposures might become biologically embedded through epigenetic effects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Biomolecular structures are assemblies of emergent anisotropic building modules such as uniaxial helices or biaxial strands. We provide an approach to understanding a marginally compact phase of matter that is occupied by proteins and DNA. This phase, which is in some respects analogous to the liquid crystal phase for chain molecules, stabilizes a range of shapes that can be obtained by sequence-independent interactions occurring intra- and intermolecularly between polymeric molecules. We present a singularity-free self-interaction for a tube in the continuum limit and show that this results in the tube being positioned in the marginally compact phase. Our work provides a unified framework for understanding the building blocks of biomolecules.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The CD44 adhesion receptor is silenced in highly malignant neuroblastomas (NBs) with MYCN amplification. Because its functional expression is associated with decreased tumorigenic properties, CD44 behaves as a tumor suppressor gene in NB and other cancers. Given that the precise mechanisms responsible for CD44 silencing are not elucidated, we investigated whether CD44 expression could be regulated by DNA hypermethylation. The methylation status of CD44 gene promoter and exon 1 regions was analyzed in 12 NB cell lines and 21 clinical samples after bisulfite genomic modification, followed by PCR and single-strand conformation polymorphism analysis and genomic sequencing. The results showed that almost all CD44-negative cell lines displayed hypermethylation in both regions, whereas all CD44-expressing cell lines were unmethylated. These observations correlated with the ability to restore CD44 mRNA and protein expression by treatment of CD44-negative cells with the 5-aza-2'-deoxycytidine demethylating agent. In contrast, no CD44 gene hypermethylation could be detected in 21 NB clinical samples of different stages, irrespective of CD44 expression. Although our results suggest that aberrant methylation of promoter and exon 1 regions is involved in CD44 silencing in NB cell lines, they also indicate that methylation of unidentified regulatory sequences or methylation-independent mechanisms also control the expression of CD44 in primary NB tumors and cell lines. We therefore conclude that CD44 silencing is controlled by complex and tumor cell-specific processes, including gene hypermethylation. Further investigation of other mechanisms and genes involved in CD44 regulation will be needed before demethylation-mediated reactivation of the CD44 gene can be considered as therapeutic strategy for neuroblastoma and perhaps other related cancers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.