Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Dissolved organic carbon in rainwater from areas heavily impacted by sugar cane burning

This work reports on rainwater dissolved organic carbon (DOC) from Ribeirao Preto (RP) and Araraquara over a period of 3 years. The economies of these two cities, located in Sao Paulo state (Brazil), are based on agriculture and related industries, and the region is strongly impacted by the burning of sugar cane foliage before harvesting. Highest DOC concentrations were obtained when air masses traversed sugar cane fields burned on the same day as the rain event. Significant increases in the DOC volume weighted means (VWM) during the harvest period, for both sites, and a good linear correlation (r=0.83) between DOC and K (a biomass burning marker) suggest that regional scale organic carbon emissions prevail over long-range transport. The DOC VWMs and standard deviations were 272 +/- 22 mu mol L-1 (n=193) and 338 +/- 40 mu mol L-1 (n=80) for RP and Araraquara, respectively, values which are at least two times higher than those reported for other regions influenced by biomass burning, such as the Amazon. These high DOC levels are discussed in terms of agricultural activities, particularly the large usage of biogenic fuels in Brazil, as well as the analytical method used in this work, which includes volatile organic carbon when reporting DOC values. Taking into account rainfall volume, estimated annual rainwater DOC fluxes for RP (4.8 g C m(-2) yr(-1)) and Araraquara (5.4 g C m(-2) yr(-1)) were close to that previously found for the Amazon region (4.8 g C m(-2) yr(-1)). This work also discusses whether previous calculations of the global rainwater carbon flux may have been underestimated, since they did not consider large inputs from biomass combustion sources, and suffered from a possible analytical bias. (c) 2008 Elsevier Ltd. All rights reserved.

Electrocatalytic oxidation of ethanol on Sn((1-x))Ir((x))O(2) electrodes in acid medium

The electrochemical oxidation of ethanol at Sn((1-x))Ir (x) O(2) electrodes (with x = 0.01, 0.05, 0.1 and 0.3) was studied in 0.1 mol L(-1) HClO(4) solution. Electrolysis experiments were carried out and the reaction products were analyzed by Liquid Chromatography. It was found that the amounts of the reaction products depended on the composition of the electrode. In situ infrared reflectance spectroscopy measurements were performed to identify the adsorbed intermediates and to postulate a reaction mechanism for ethanol electrooxidation on these electrode materials. As evidence, acetaldehyde and acetic acid were formed through a successive reaction process. Carbon dioxide was also identified as the end product, showing that the cleavage of the carbon-carbon bond occurred. These results indicate that the synthesized catalysts are able to lead to the total combustion of organic compounds. Analysis of the water bending band at different potentials illustrated its role at the electrode interface.

Cerium-based phosphors: blue luminescent properties for applications in optical displays

In this paper, we describe the blue photoluminescence (PL) observed in the multi-component oxosalt phosphor GdVO(4)center dot Ce(3+). Different doping concentrations (0.25-1 mol%) and heat treatment (900-1100 degrees C) were used to evaluate which conditions would lead to the most suitable blue phosphor for optimal display performance. The cerium doping concentration influences the profile of the emission spectrum (broad peak at 412 nm under UV excitation at 330 nm), as reflected on the values of chromaticity coordinates. On the basis of luminescent properties, we can conclude that, among the phosphors prepared in this work the most adequate for a blue display is the one obtained via the combustion method using glycine as fuel, a 0.50 mol% cerium doping concentration, and heat treatment at 1000 degrees C.

Amphiphilic cerium(III) beta-diketonate as a catalyst for reducing diesel/biodiesel soot emissions

This work reports on the synthesis, characterization and applications of the new cerium(III) beta-diketonate Ce(hdacac)(3)(Hhdacac)(3)center dot 2H(2)O (where hdacac and Hhdacac denote, respectively, the hexadecylpentane-2,4-dionate and hexadecylpentane-2,4-dione ligands) as catalyst for the reduction of automotive emissions. Due to its amphiphilic character, this complex can be solubilized in non-polar fuels, thus generating cerium(IV) oxide particles, which efficiently catalyze the oxidation of diesel/biodiesel soot. The synthesized complex was characterized by microanalysis (C, H), thermal analysis, and infrared spectroscopy. Scanning electron microscopy, X-ray diffractometry, and specific surface area measurements attested that the complex can act as a soluble precursor of homogeneous CeO(2) spherical nanoparticles. The efficiency of this compound as catalyst for the reduction of soot emission was evaluated through static studies (comprising carbon black oxidation), which confirmed that increasing concentrations of the complex result in lower carbon black oxidation temperatures and lower activation Gibbs free energies. Dynamic studies, which embraced the combustion of diesel/biodiesel blends containing different amounts of the solubilized complex in a stationary motor, allowed a comparative evaluation of the soot emission through diffuse reflectance spectroscopy. These analyses provided very emphatic evidences of the efficiency of this new cerium complex for the control of soot emission in diesel/biodiesel motors. (c) 2009 Published by Elsevier B.V.

Timing of rotator cuff activation during shoulder external rotation in throwers with and without symptoms of pain

Study Design: Fine-wire EMG rotator cuff onset time analysis in 2 matched groups of throwers with and without pain. Objective: To identify if there is a difference in the activation patterns of the rotator cuff muscles during a rapid shoulder external rotation task between throwers with and without pain. Background: The coordinated action of the rotator cuff is recognized as essential for glenohumeral joint control in the throwing athlete. Identification of abnormalities occurring in muscle activation patterns for injured athletes is relevant when prescribing rehabilitative exercises. Methods and Measures: Twelve throwers with shoulder pain were compared to a matched group of 11 asymptomatic throwers. Participants were matched for age, height, body mass, and habitual activity. Fine-wire EMG electrodes were inserted into the subscapularis, supraspinatus, and infraspinatus. EMG activity was measured during a reaction time task of rapid shoulder external rotation in a seated position. The timing of onset of EMG activity was analyzed in relation to visualization of a light (reaction time) and to the onset of infraspinatus activity (relative latency). Results: In the group with shoulder pain, the onset of subscapularis activity was found to be significantly delayed (reaction time, P = .0018; relative latency, P = .0005) from the onset of infraspinatus activity when compared to the control group. Conclusions: The presence of shoulder pain in these athletes was associated with a difference in the onset of subscapularis EMG activity during a rapid shoulder external rotation movement. This was an initial step in the understanding of the joint protection mechanisms of the glenohumeral joint and the problems that occur in throwers. This information may assist in providing future guidelines for more effective rehabilitation and prevention strategies for this condition.

Modelling of species in hood fires by conditional moment closure

Carbon monoxide, the chief killer in fires, and other species are modelled for a series of enclosure fires. The conditions emulate building fires where CO is formed in the rich, turbulent, nonpremixed flame and is transported frozen to lean mixtures by the ceiling jet which is cooled by radiation and dilution. Conditional moment closure modelling is used and computational domain minimisation criteria are developed which reduce the computational cost of this method. The predictions give good agreement for CO and other species in the lean, quenched-gas stream, holding promise that this method may provide a practical means of modelling real, three-dimensional fire situations. (c) 2005 The Combustion Institute. Published by Elsevier Inc. All rights reserved.

Review of genetic and epigenetic alterations in hepatocarcinogenesis

Hepatocellular carcinoma (HCC) is associated with multiple risk factors and is believed to arise from pre-neoplastic lesions, usually in the background of cirrhosis. However, the genetic and epigenetic events of hepatocarcinogenesis are relatively poorly understood. HCC display gross genomic alterations, including chromosomal instability (CIN), CpG island methylation, DNA rearrangements associated with hepatitis B virus (HBV) DNA integration, DNA hypomethylation and, to a lesser degree, microsatellite instability. Various studies have reported CIN at chromosomal regions, 1p, 4q, 5q, 6q, 8p, 10q, 11p, 16p, 16q, 17p and 22q. Frequent promoter hypermethylation and subsequent loss of protein expression has also been demonstrated in HCC at tumor suppressor gene (TSG), p16, p14, p15, SOCS1, RIZ1, E-cadherin and 14-3-3 sigma. An interesting observation emerging from these studies is the presence of a methylator phenotype in hepatocarcinogenesis, although it does not seem advantageous to have high levels of microsatellite instability. Methylation also appears to be an early event, suggesting that this may precede cirrhosis. However, these genes have been studied in isolation and global studies of methylator phenotype are required to assess the significance of epigenetic silencing in hepatocarcinogenesis. Based on previous data there are obvious fundamental differences in the mechanisms of hepatic carcinogenesis, with at least two distinct mechanisms of malignant transformation in the liver, related to CIN and CpG island methylation. The reason for these differences and the relative importance of these mechanisms are not clear but likely relate to the etiopathogenesis of HCC. Defining these broad mechanisms is a necessary prelude to determine the timing of events in malignant transformation of the liver and to investigate the role of known risk factors for HCC.

Numerical simulation of double-diffusion driven convective flow and rock alteration in three-dimensional fluid-saturated geological fault zones

Numerical methods are used to simulate the double-diffusion driven convective pore-fluid flow and rock alteration in three-dimensional fluid-saturated geological fault zones. The double diffusion is caused by a combination of both the positive upward temperature gradient and the positive downward salinity concentration gradient within a three-dimensional fluid-saturated geological fault zone, which is assumed to be more permeable than its surrounding rocks. In order to ensure the physical meaningfulness of the obtained numerical solutions, the numerical method used in this study is validated by a benchmark problem, for which the analytical solution to the critical Rayleigh number of the system is available. The theoretical value of the critical Rayleigh number of a three-dimensional fluid-saturated geological fault zone system can be used to judge whether or not the double-diffusion driven convective pore-fluid flow can take place within the system. After the possibility of triggering the double-diffusion driven convective pore-fluid flow is theoretically validated for the numerical model of a three-dimensional fluid-saturated geological fault zone system, the corresponding numerical solutions for the convective flow and temperature are directly coupled with a geochemical system. Through the numerical simulation of the coupled system between the convective fluid flow, heat transfer, mass transport and chemical reactions, we have investigated the effect of the double-diffusion driven convective pore-fluid flow on the rock alteration, which is the direct consequence of mineral redistribution due to its dissolution, transportation and precipitation, within the three-dimensional fluid-saturated geological fault zone system. (c) 2005 Elsevier B.V. All rights reserved.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Multifidus muscle recovery is not automatic after resolution of acute, first-episode low back pain

Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.

Hemodynamic Changes during Myocardial Revascularization without Extracorporeal Circulation

Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.

Urodynamic evaluation of patients with lower urinary tract symptoms and small prostate volume

Introduction: The relevance of prostate size in the pathophysiology of lower urinary tract symptoms (LUTS) is controversial. We evaluated the urodynamic findings in patients with LUTS and small prostate volumes. Materials and Methods: 84 patients aged >= 50 years with LUTS and prostates < 40 ml were evaluated. All had an International Prostate Symptom Score (IPSS) >= 8. Average age was 62.0 +/- 8.1 years. We evaluated the impact of bladder outlet obstruction (BOO) and detrusor overactivity (DO) on the voiding symptoms and urodynamic findings. Results: Mean prostate volume was 29.2 +/- 7.2 ml and mean IPSS was 13.5 +/- 4.6. BOO was the main finding, affecting 42 (50.0%) patients, followed by detrusor underactivity (DU) in 41 (48.8%) and DO in 28 (33.3%) patients. Patients without BOO were significantly older than the obstructed (64.0 +/- 8.8 and 60.1 +/- 6.9 years, respectively; p = 0.026) and had an increased prevalence of DU (76.2 and 21.4%, respectively; p < 0.001). Comparison of patients with and without DO showed reduced bladder capacity and compliance in the DO group (p < 0.001). No other comparisons were significant. Conclusion: Half of the patients with LUTS and small prostates are not obstructed and may have DO or decreased detrusor contractility as the basis for their voiding symptoms. Our results emphasize the value of urodynamics in this population, especially when invasive treatments are being considered. Copyright (c) 2008 S. Karger AG, Basel.

Bladder Compliance What Does it Represent: Can We Measure it, and is it Clinically Relevant?

Aims: To report the conclusion of the Think Thank 8 on Compliance Discussions during the second ICI-RS meeting in 2010. Methods: During a 3-day meeting a group of specialists discussed bladder compliance, what it represents, how it can be measured and if it is clinically relevant. Results: Bladder compliance is the result of a mathematical calculation of the volume required for a unit rise of pressure measured during a cystometric filling. It gives an indication on how the different mechanisms in the bladder wall react on stretching. There is a need of standardization of measurement and suggestions for this are given in the text. Pitfalls are described and how to avoid them. There is a wide range of compliance values in healthy volunteers and groups of patients. Poor compliance needs to be defined better as it can have significant clinical consequences. Prevention and treatment are discussed. Conclusion: If compliance is correctly measured and interpreted, it has importance in urodynamic testing and gives information relevant for clinical management. Neurourol. Urodynam. 30:714-722, 2011. (C) 2011 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).