Relationship between pulmonary function and indoor air pollution from coal combustion among adult residents in an inner-city area of southwest China

Few studies evaluate the amount of particulate matter less than 2.5 mm in diameter (PM2.5) in relation to a change in lung function among adults in a population. The aim of this study was to assess the association of coal as a domestic energy source to pulmonary function in an adult population in inner-city areas of Zunyi city in China where coal use is common. In a cross-sectional study of 104 households, pulmonary function measurements were assessed and compared in 110 coal users and 121 non-coal users (≥18 years old) who were all nonsmokers. Several sociodemographic factors were assessed by questionnaire, and ventilatory function measurements including forced vital capacity (FVC), forced expiratory volume in 1 s (FEV1), the FEV1/FVC ratio, and peak expiratory flow rate (PEFR) were compared between the 2 groups. The amount of PM2.5 was also measured in all residences. There was a significant increase in the relative concentration of PM2.5 in the indoor kitchens and living rooms of the coal-exposed group compared to the non-coal-exposed group. In multivariate analysis, current exposure to coal smoke was associated with a 31.7% decrease in FVC, a 42.0% decrease in FEV1, a 7.46% decrease in the FEV1/FVC ratio, and a 23.1% decrease in PEFR in adult residents. The slope of lung function decrease for Chinese adults is approximately a 2-L decrease in FVC, a 3-L decrease in FEV1, and an 8 L/s decrease in PEFR per count per minute of PM2.5 exposure. These results demonstrate the harmful effects of indoor air pollution from coal smoke on the lung function of adult residents and emphasize the need for public health efforts to decrease exposure to coal smoke.

Possible roles of COX-1 in learning and memory impairment induced by traumatic brain injury in mice

People who suffer from traumatic brain injury (TBI) often experience cognitive deficits in spatial reference and working memory. The possible roles of cyclooxygenase-1 (COX-1) in learning and memory impairment in mice with TBI are far from well known. Adult mice subjected to TBI were treated with the COX-1 selective inhibitor SC560. Performance in the open field and on the beam walk was then used to assess motor and behavioral function 1, 3, 7, 14, and 21 days following injury. Acquisition of spatial learning and memory retention was assessed using the Morris water maze on day 15 post-TBI. The expressions of COX-1, prostaglandin E2 (PGE2), interleukin (IL)-6, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor BB (PDGF-BB), synapsin-I, and synaptophysin were detected in TBI mice. Administration of SC560 improved performance of beam walk tasks as well as spatial learning and memory after TBI. SC560 also reduced expressions of inflammatory markers IL-6 and PGE2, and reversed the expressions of COX-1, BDNF, PDGF-BB, synapsin-I, and synaptophysin in TBI mice. The present findings demonstrated that COX-1 might play an important role in cognitive deficits after TBI and that selective COX-1 inhibition should be further investigated as a potential therapeutic approach for TBI.

Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C2H2 zinc finger protein

Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Correlation between heart rate variability and pulmonary function adjusted by confounding factors in healthy adults

The autonomic nervous system maintains homeostasis, which is the state of balance in the body. That balance can be determined simply and noninvasively by evaluating heart rate variability (HRV). However, independently of autonomic control of the heart, HRV can be influenced by other factors, such as respiratory parameters. Little is known about the relationship between HRV and spirometric indices. In this study, our objective was to determine whether HRV correlates with spirometric indices in adults without cardiopulmonary disease, considering the main confounders (e.g., smoking and physical inactivity). In a sample of 119 asymptomatic adults (age 20-80 years), we evaluated forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1). We evaluated resting HRV indices within a 5-min window in the middle of a 10-min recording period, thereafter analyzing time and frequency domains. To evaluate daily physical activity, we instructed participants to use a triaxial accelerometer for 7 days. Physical inactivity was defined as <150 min/week of moderate to intense physical activity. We found that FVC and FEV1, respectively, correlated significantly with the following aspects of the RR interval: standard deviation of the RR intervals (r =0.31 and 0.35), low-frequency component (r =0.38 and 0.40), and Poincaré plot SD2 (r =0.34 and 0.36). Multivariate regression analysis, adjusted for age, sex, smoking, physical inactivity, and cardiovascular risk, identified the SD2 and dyslipidemia as independent predictors of FVC and FEV1 (R2=0.125 and 0.180, respectively, for both). We conclude that pulmonary function is influenced by autonomic control of cardiovascular function, independently of the main confounders.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.

Thermophysical and rheological properties of dulce de leche with and without coconut flakes as a function of temperature

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Thermodynamic properties of water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content

The Jackfruit tree is one of the most significant trees in tropical home gardens and perhaps the most widespread and useful tree in the important genus Artocarpus. The fruit is susceptible to mechanical and biological damage in the mature state, and some people find the aroma of the fruit objectionable, particularly in confined spaces. The dehydration process could be an alternative for the exploitation of this product, and the relationship between moisture content and water activity provides useful information for its processing and storage. The aim of this study was to determine the thermodynamic properties of the water sorption of jackfruit (Artocarpus heterophyllus Lam.) as a function of moisture content. Desorption isotherms of the different parts of the jackfruit (pulp, peduncle, mesocarp, peel, and seed) were determined at four different temperatures (313.15, 323.15, 333.15, and 343.15 K) in a water activity range of 0.02-0.753 using the static gravimetric method. Theoretical and empirical models were used to model the desorption isotherms. An analytical solution of the Clausius-Clapeyron equation was proposed to calculate the isosteric heat of sorption, the differential entropy, and Gibbs' free energy using the Guggenhein-Anderson-de Boer and Oswin models considering the effect of temperature on the hygroscopic equilibrium.

The long-term use of enalapril and hydrochlorothiazide in two novel mutations patients with Dent's disease type 1

Dent's disease type 1 is an X-linked tubular disease caused by mutations in the renal chloride channel CLCN-5, and it is characterized by low molecular weight proteinuria, hypercalciuria, nephrocalcinosis, and renal failure. Several cases have been described in which the only presenting symptoms were asymptomatic proteinuria, and focal segmental or global glomerulosclerosis. The renal failure in these patients may be caused by hypercalciuria and persistent proteinuria. Therefore, angiotensin converse enzyme inhibitor and thiazides could be useful. Our aim is to report the effects of these drugs in two novel mutations patients with Dent's disease type 1. In this report, no significant correlations between dosage of hydrochlorothiazide and calciuria and no significant correlations between proteinuria and dosage of enalapril were detected. This is important since these are polyuric patients and these drugs could be dangerous to their renal function.

Early initiation of dialysis: mortality and renal function recovery in acute kidney injury patients

INTRODUCTION: The decision of when to start dialysis in Acute Kidney Injury (AKI) patients with overt uremia is strongly established, however, when blood urea nitrogen (BUN) levels is < 100 mg/dL the timing of initiation of dialysis remains uncertain. Purpose: The aim of this study was to assess mortality and renal function recovery AKI patients started on dialysis at different BUN levels. METHODS: This was a retrospective study performed at Medical School Hospital, São Paulo, Brazil, enrolling 86 patients underwent to dialysis. RESULTS: Dialysis was started when BUN < 75 mg/dl in 23 patients (Group I) and BUN > 75 mg/dl in 63 patients (Group II). Hypervolemia and mortality were higher in Group I than in Group II (65.2% vs. 14.3% - p < 0.05, 39.1% vs. 68.9%- p < 0.05, respectively). Among survivors, the rate of renal function recovery was higher in Group I (71.4% and 36.8%, respectively - p < 0.05). Multivariate analysis showed that sepsis, age > 60 years, peritoneal dialysis and BUN > 75 mg/dl at dialysis initiation were independently related with mortality. CONCLUSIONS: Lower mortality and higher renal function recovery rates were associated with early dialysis initiated at lower BUN leves in AKI patients.

CLEVER-1 as an immune suppressive molecule

The immune response and immune suppression are equally essential for the immune system to protect the host against an infection and to protect self-molecules in different pathophysiological conditions. Pregnancy is one of the conditions where the maternal immune system remains resistant against microbes and yet attains tolerance to protect the fetus, whose genetic material differs partially from the mother’s. However, if the balance of immune suppression is not precise in the host it can favor conditions which lead to diseases, such as cancer and autoimmune disorders. This study was initiated to investigate the expression and functions of CLEVER-1/Stabilin-1, a multifunctional protein expressed on subsets of endothelial cells and type II macrophages, as an immune suppressive molecule. Firstly, the expression of CLEVER-1/stabilin-1 and its function in human placental macrophages were examined. Secondly, the expression profile and functional significance of stabilin-1 on healthy human monocytes was investigated. The results clarified the expression of CLEVER-1/stabilin-1 on placental macrophages, and verified that CLEVER-1/stabilin-1 functions as an adhesion and scavenging molecule on these cells. The data from normal monocytes revealed that the monocytes with low stabilin-1 expression carried a pro-inflammatory gene signature, and that stabilin-1 can directly or indirectly regulate pro-inflammatory genes in monocytes. Finally, it was shown that monocyte CLEVER-1/stabilin-1 dampens IFN production by T cells. To conclude, CLEVER-1/stabilin-1 is defined as an immune suppressive molecule on monocytes and macrophages. Strikingly, anti-stabilin-1 antibodies may have the potential to promote the Th1 dependent inflammatory response and counteract the tumor induced immune suppression.

Novel cancer-related regulatory targets for the signalling sphingolipids sphingosine-1-phosphate and sphingosylphosphorylcholine

The signalling sphingolipid sphingosine-1-phosphate (S1P) is necessary for development of the immune system and vasculature and on a cellular level regulates migration, proliferation and survival. Due to these traits S1P has an important role in cancer biology. It is considered a primarily cancer-promoting factor and the enzyme which produces it, sphingosine kinase (SphK), is often over-expressed in tumours. S1P is naturally present in the blood, lymph, tissue fluids and cell cytoplasm and functions through its cell surface receptors (S1P1-5) and as an intracellular second messenger. Sphingosylphosphorylcholine (SPC) is closely related to S1P and has similar regulatory functions but has not been extensively studied. Both S1P and SPC are able to evoke either stimulatory or inhibitory effects on cancer cells depending on the context. The aim of this thesis work was to study novel regulatory targets of S1P and SPC, which mediate the effects of S1P/SPC signalling on cancer cell behaviour. The investigated targets are the transcription factor hypoxia-inducible factor 1 (HIF-1), the intermediate filament protein vimentin and components of the Hippo signalling pathway. HIF-1 has a central role in cancer biology, as it regulates a multitude of cancer-related genes and is potently activated by intratumoural hypoxia through stabilization of the regulatory subunit HIF-1α. Tumours typically harbour high HIF-1α levels and HIF-1, in turn, facilitates tumour angiogenesis and metastasis and regulates cancer cell metabolism. We found S1P to induce follicular thyroid cancer cell migration in normal oxygen conditions by increasing HIF-1α synthesis and stability and subsequently HIF-1 activity. Vimentin is a central regulator of cell motility and is also commonly over-expressed in cancers. Vimentin filaments form a cytoskeletal network in mesenchymal cells as well as epithelial cancer cells which have gone through epithelial-mesenchymal transition (EMT). Vimentin is heavily involved in cancer cell invasion and gives tumours metastatic potential. We saw both S1P and SPC induce phosphorylation of vimentin monomers and reorganization of the vimentin filament network in breast and anaplastic thyroid cancer cells. We also found vimentin to mediate the anti-migratory effect of S1P/SPC on these cells. The Hippo pathway is a novel signalling cascade which controls cancer-related processes such as cellular proliferation and survival in response to various extracellular signals. The core of the pathway consists of the transcriptional regulators YAP and TAZ, which activate predominantly cancer-promoting genes, and the tumour suppressive kinases Lats1 and Lats2 which inhibit YAP/TAZ. Increased YAP expression and activity has been reported for a wide variety of cancers. We found SPC to regulate Hippo signalling in breast cancer cells in a two-fold manner through effects on phosphorylation status, activity and/or expression of YAP and Lats2. In conclusion, this thesis reveals new details of the signalling function of S1P and SPC and regulation of the central oncogenic factors HIF-1 and vimentin as well as the novel cancer-related pathway Hippo.

Does Gamma-aminobutyric acid function as a plant resistance mechanism against phytophagous insect activity? /

Gamma-aminobutyric acid (GAB A) is a ubiquitous non-protein amino acid synthesized via the decarboxylation of L-glutamate in a reaction catalyzed by the cytosolic enzyme L-glutamate decarboxylase (GAD). In animals it functions as an inhibitory neurotransmitter. In plants it accumulates rapidly in response to various stresses, but its function remains unclear. The hypothesis that GABA accumulation in leaf tissue may function as a plant resistance mechanism against phytophagous insect activity was investigated. GABA accumulation in response to mechanical stimulation, mechanical damage and insect activity was demonstrated. In wt tobacco (Nicotiana tabacum cv Samsun), mechanical stimulation or damage caused GABA to accumulate within 2 min from mean levels of 14 to 37 and 1~9 nmol g-l fresh weight (FW), respectively. In the transgenic tobacco strain CaMVGAD27c overexpressing Petunia GAD, the same treatments caused GABA to accumulate from 12 to 59 and 279 nmol g-l FW, respectively. In the transgenic tobacco strain CaMVGADilC 11 overexpressing Petunia GAD lacking an autoinhibitory domain, mechanical stimulation or damage caused GABA to accumulate from 180 to 309 and 630 nmol g-l FW, respectively. Ambulatory activity by tobacco budworm (TBW) larvae (Heliothis virescens) on leaves of CaMVGAD27c tobacco caused GABA to accumulate from 28 to 80 nmol g-l FW within 5 min. Ambulatory and leaf-rolling activity by oblique banded leaf roller (OBLR) larvae (Choristoneura rosaceana cv Harris) on wt soybean leaves (Glycine max cv Harovinton) caused GABA to accumulate from 60 to 1123 nmol g-l FW within 20 min. Increased GABA levels in leaf tissue were shown to affect phytophagous preference in TBW larvae presented with wt and transgenic tobacco leaves. When presented with leaves of Samsun wt and CaMVGAD27c plants, TBW larvae consumed more wt leaf tissue (640 ± 501 S.D. mm2 ) than transgenic leaf tissue (278 ± 338 S.D. mm2 ) nine times out of ten. When presented with leaves of Samsun wt and CaMVGAD~C11 plants, TBW larvae consumed more transgenic leaf tissue (1219 ± 1009 S.D. mm2 ) than wt leaf tissue (28 ± 31 S.D. mm2 ) ten times out of ten. These results indicate that: (1) ambulatory activity of insect larvae on leaves results in increased GABA levels, (2) transgenic tobacco leaves with increased capacity for GABA synthesis deter feeding, and (3) transgenic tobacco leaves with constitutively higher GABA levels stimulate feeding.