Decreased food intake does not completely account for adiposity reduction after ob protein infusion.

The effects of recombinantly produced ob protein were compared to those of food restriction in normal lean and genetically obese mice. Ob protein infusion into ob/ob mice resulted in large decreases in body and fat-depot weight and food intake that persisted throughout the study. Smaller decreases in body and fat-depot weights were observed in vehicle-treated ob/ob mice that were fed the same amount of food as that consumed by ob protein-treated ob/ob mice (pair feeding). In lean mice, ob protein infusion significantly decreased body and fat-depot weights, while decreasing food intake to a much lesser extent than in ob/ob mice. Pair feeding of lean vehicle-treated mice to the intake of ob protein-treated mice did not reduce body fat-depot weights. The potent weight-, adipose-, and appetite-reducing effects exerted by the ob protein in ob protein-deficient mice (ob/ob) confirm hypotheses generated from early parabiotic studies that suggested the existence of a circulating satiety factor of adipose origin. Pair-feeding studies provide compelling evidence that the ob protein exerts adipose-reducing effects in excess of those induced by reductions in food intake.

Vitronectin is not essential for normal mammalian development and fertility.

Vitronectin (VN) is an abundant glycoprotein present in plasma and the extracellular matrix of most tissues. Though the precise function of VN in vivo is unknown, it has been implicated as a participant in diverse biological processes, including cell attachment and spreading, complement activation, and regulation of hemostasis. The major site of synthesis appears to be the liver, though VN is also found in the brain at an early stage of mouse organogenesis, suggesting that it may play an important role in mouse development. Genetic deficiency of VN has not been reported in humans or in other higher organisms. To examine the biologic function of VN within the context of the intact animal, we have established a murine model for VN deficiency through targeted disruption of the murine VN gene. Southern blot analysis of DNA obtained from homozygous null mice demonstrates deletion of all VN coding sequences, and immunological analysis confirms the complete absence of VN protein expression in plasma. However, heterozygous mice carrying one normal and one null VN allele and homozygous null mice completely deficient in VN demonstrate normal development, fertility, and survival. Sera obtained from VN-deficient mice are completely deficient in "serum spreading factor" and plasminogen activator inhibitor 1 binding activities. These observations demonstrate that VN is not essential for cell adhesion and migration during normal mouse development and suggest that its role in these processes may partially overlap with other adhesive matrix components.

Equine severe combined immunodeficiency: a defect in V(D)J recombination and DNA-dependent protein kinase activity.

V(D)J rearrangement is the molecular mechanism by which an almost infinite array of specific immune receptors are generated. Defects in this process result in profound immunodeficiency as is the case in the C.B-17 SCID mouse or in RAG-1 (recombination-activating gene 1) or RAG-2 deficient mice. It has recently become clear that the V(D)J recombinase most likely consists of both lymphoid-specific factors and ubiquitously expressed components of the DNA double-strand break repair pathway. The deficit in SCID mice is in a factor that is required for both of these pathways. In this report, we show that the factor defective in the autosomal recessive severe combined immunodeficiency of Arabian foals is required for (i) V(D)J recombination, (ii) resistance to ionizing radiation, and (iii) DNA-dependent protein kinase activity.

Platelets roll on stimulated endothelium in vivo: an interaction mediated by endothelial P-selectin.

P-selectin, found in storage granules of platelets and endothelial cells, can be rapidly expressed upon stimulation. Mice lacking this membrane receptor exhibit a severe impairment of leukocyte rolling. We observed that, in addition to leukocytes, platelets were rolling in mesenteric venules of wild-type mice. To investigate the role of P-selectin in this process, resting or activated platelets from wild-type or P-selectin-deficient mice were fluorescently labeled and transfused into recipients of either genotype. Platelet-endothelial interactions were monitored by intravital microscopy. We observed rolling of either wild-type or P-selectin-deficient resting platelets on wild-type endothelium. Endothelial stimulation with the calcium ionophore A23187 increased the number of platelets rolling 4-fold. Activated P-selectin-deficient platelets behaved similarly, whereas activated wild-type platelets bound to leukocytes and were seen rolling together. Platelets of either genotype, resting or activated, interacted minimally with mutant endothelium even after A23187 treatment. The velocity of platelet rolling was 6- to 9-fold greater than that of leukocytes. Our results demonstrate that (i) platelets roll on endothelium in vivo, (ii) this interaction requires endothelial but not platelet P-selectin, and (iii) platelet rolling appears to be independent of platelet activation, indicating constitutive expression of a P-selectin ligand(s) on platelets. We have therefore observed an interesting parallel between platelets and leukocytes in that both of these blood cell types roll on stimulated vessel wall and that this process is dependent on the expression of endothelial P-selectin.

Homeostatic regulation of intestinal epithelia by intraepithelial gamma delta T cells.

Although T cells bearing gamma delta T-cell receptors have long been known to be present in the epithelial lining of many organs, their specificity and function remain elusive. In the present study, we examined the intestinal epithelia of T-cell-receptor mutant mice, which were deficient in either gamma delta T cells or alpha beta T cells, and of normal littermates. The absence of gamma delta T cells was associated with a reduction in epithelial cell turnover and a downregulation of the expression of major histocompatibility complex class II molecules. No such effects were observed in alpha beta T-cell-deficient mice. These findings indicate that intraepithelial gamma delta T cells regulate the generation and differentiation of intestinal epithelial cells.

Natural killer and lymphokine-activated killer cells require granzyme B for the rapid induction of apoptosis in susceptible target cells.

Granzyme (Gzm) B-deficient mice obtained by gene targeting were used to assess the role of Gzm B in the mechanisms used by natural killer (NK) and lymphokine-activated killer (LAK) cells to destroy target cells. Gzm B-/- NK cells, LAK cells, and cytotoxic T lymphocytes (CTL) all are defective in their ability to rapidly induce DNA fragmentation/apoptosis in susceptible target cells. This defect can be partially corrected with long incubation times of effector and target cells. Moreover, Gzm B-/- NK cells (but not CTL or LAK cells) exhibit a defect in 51Cr release from susceptible target cells. This 51Cr release defect in Gzm B-deficient NK cells is also not overcome by prolonged incubation times or high effector-to-target cell ratios. We conclude that Gzm B plays a critical and nonredundant role in the rapid induction of DNA fragmentation/apoptosis by NK cells, LAK cells, and CTL. Gzm B may have an additional role in NK cells (but not in CTL or LAK cells) for mediating 51Cr release.

Functional expression of low density lipoprotein receptor-related protein is controlled by receptor-associated protein in vivo.

The 39-kDa receptor-associated protein (RAP) associates with the multifunctional low density lipoprotein (LDL) receptor-related protein (LRP) and thereby prevents the binding of all known ligands, including alpha 2-macroglobulin and chylomicron remnants. RAP is predominantly localized in the endoplasmic reticulum, raising the possibility that it functions as a chaperone or escort protein in the biosynthesis or intracellular transport of LRP. Here we have used gene targeting to show that RAP promotes the expression of functional LRP in vivo. The amount of mature, processed LRP is reduced in liver and brain of RAP-deficient mice. As a result, hepatic clearance of alpha 2-macroglobulin is impaired and remnant lipoproteins accumulate in the plasma of RAP-deficient mice that also lack functional LDL receptors. These results are consistent with the hypothesis that RAP stabilizes LRP within the secretory pathway. They also suggest a further mechanism by which the activity of an endocytic receptor may be modulated in vivo.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Effet du CP-3(iv), un ligand du récepteur CD36, sur le stress oxydatif suite à une ischémie cardiaque transitoire chez la souris

Le récepteur éboueur CD36 facilite l’internalisation des acides gras libres non estérifiés (AGNE) au niveau des tissus cardiaque et périphériques. Lors d’une ischémie-reperfusion du myocarde (MI/R), les dommages produits sont en partie liés à l’internalisation des AGNE et à la production d’espèces réactives de l’oxygène, contrairement à ce qui est observé chez des souris déficientes en CD36 (CD36-/-). Nous avons émis l’hypothèse selon laquelle le CP-3(iv), un ligand synthétique du récepteur CD36, exercerait un effet cardioprotecteur en réduisant la taille de la zone myocardique infarcie lors d’une ischémie transitoire du myocarde. Nos objectifs étaient 1) de déterminer l’effet cardioprotecteur du CP-3(iv) et 2) de définir son mécanisme. Pour cela, des études in vivo et ex vivo ont été faites. Des souris de type sauvage ont été traitées avec le CP-3(iv) (289 nmol/kg) par voie sous-cutanée pendant 14 jours avant d’être soumises à 30 minutes d’ischémie suivant la ligature de l’artère coronaire gauche descendante et de sa reperfusion pendant une période de 6 ou 48 heures. De plus, des coeurs isolés de souris ont été perfusés 30 minutes, suivi de 40 minutes à faible débit (10%) et de 30 minutes de reperfusion pendant laquelle le coeur est perfusé avec le CP-3(iv) à une concentration de 10-6 M. Nos travaux ont montré que l’effet cardioprotecteur d’un traitement préventif par le CP-3(iv) permet de diminuer la taille de l’infarctus et préserve l’hémodynamie cardiaque de façon dépendante du CD36 puisque cet effet est non visible chez les souris CD36-/-. De plus, le CP-3(iv) exerce non seulement un effet systémique, mais aussi un effet cardioprotecteur direct sur le coeur isolé.

Association between apolipoprotein E epsilon 4 and neuropsychiatric symptoms during interferon alpha treatment for chronic hepatitis C

Neuropsychiatric complications are common in patients with chronic hepatitis C undergoing treatment with interferon alpha. These side effects include alterations of mood, cognition, and neuroendocrine function and are unpredictable. In a number of neurological disorders characterized by neuropsychiatric symptoms and cognitive dysfunction, inheritance of an apolipoprotein E (APOE) epsilon4 allele is associated with adverse neuropsychiatric outcomes. The authors present evidence that the APOE genotype may influence a patient's neuropsychiatric response to interferon alpha treatment. The inheritance of APOE genotypes was examined in 110 patients with chronic hepatitis C treated with interferon alpha. A retrospective investigation was conducted by assessing the rates of psychiatric referral and neuropsychiatric symptoms experienced during treatment along with other complaints indicating psychological distress. A highly statistically significant association was seen between APOE genotypes and interferon-induced neuropsychiatric symptoms. Patients with an epsilon4 allele were more likely to be referred to a psychiatrist and had more neuropsychiatric symptoms during antiviral treatment than those without an epsilon4 allele. Additionally, patients with an epsilon4 allele were more likely to experience irritability or anger and anxiety or other mood symptoms. These data demonstrate that an individual's APOE genotype may influence the neuropsychiatric response to antiviral therapy with interferon alpha. Prospective studies evaluating the importance of APOE in susceptibility to interferon alpha-induced neuropsychiatric complications are needed. Moreover, pathways involving APOE should be considered in understanding the pathophysiology of interferon alpha-induced neuropsychiatric complications.

Caveolins in the repair phase of acute renal failure after oxidative stress

Ischaemia-reperfusion and toxic injury are leading causes of acute renal failure (ARF). Both of these injury initiators use secondary mediators of damage in oxygen-derived free radicals. Several recent publications about ischaemia-reperfusion and toxin-induced ARF have indicated that plasma membrane structures called caveolae, and their proteins, the caveolins, are potential participants in protecting or repairing renal tissues. Caveolae and caveolins have previously been ascribed many functions, a number of which may mediate cell death or survival of injured renal cells. This review proposes possible pathophysiological mechanisms by which altered caveolin-1 expression and localization may affect renal cell survival following oxidative stress.

Skeletal muscle and nuclear hormone receptors: Implications for cardiovascular and metabolic disease

Skeletal muscle is a major mass peripheral tissue that accounts for similar to 40% of the total body mass and a major player in energy balance. It accounts for > 30% of energy expenditure, is the primary tissue of insulin stimulated glucose uptake, disposal, and storage. Furthermore, it influences metabolism via modulation of circulating and stored lipid (and cholesterol) flux. Lipid catabolism supplies up to 70% of the energy requirements for resting muscle. However, initial aerobic exercise utilizes stored muscle glycogen but as exercise continues, glucose and stored muscle triglycerides become important energy substrates. Endurance exercise increasingly depends on fatty acid oxidation (and lipid mobilization from other tissues). This underscores the importance of lipid and glucose utilization as an energy source in muscle. Consequently skeletal muscle has a significant role in insulin sensitivity, the blood lipid profile, and obesity. Moreover, caloric excess, obesity and physical inactivity lead to skeletal muscle insulin resistance, a risk factor for the development of type II diabetes. In this context skeletal muscle is an important therapeutic target in the battle against cardiovascular disease, the worlds most serious public health threat. Major risk factors for cardiovascular disease include dyslipidemia, hypertension, obesity, sedentary lifestyle, and diabetes. These risk factors are directly influenced by diet, metabolism and physical activity. Metabolism is largely regulated by nuclear hormone receptors which function as hormone regulated transcription factors that bind DNA and mediate the pathophysiological regulation of gene expression. Metabolism and activity, which directly influence cardiovascular disease risk factors, are primarily driven by skeletal muscle. Recently, many nuclear receptors expressed in skeletal muscle have been shown to improve glucose tolerance, insulin resistance, and dyslipidernia. Skeletal muscle and nuclear receptors are rapidly emerging as critical targets in the battle against cardiovascular disease risk factors. Understanding the function of nuclear receptors in skeletal muscle has enormous pharmacological utility for the treatment of cardiovascular disease. This review focuses on the molecular regulation of metabolism by nuclear receptors in skeletal muscle in the context of dyslipidemia and cardiovascular disease. (c) 2005 Published by Elsevier Ltd.

Semliki Forest virus and Kunjin virus RNA replicons elicit comparable cellular immunity but distinct humoral immunity

RNA replicons offer a number of qualities which make them attractive as vaccination vectors. Both alphavirus and flavivirus replicon vaccines have been investigated in preclinical models yet there has been little direct comparison of the two vector systems. To determine whether differences in the biology of the two vectors influence immunogenicity, we compared two prototypic replicon vectors based on Semliki Forest virus (SFV) (alphavirus) and Kunjin virus (KUN) (flavivirus). Both vectors when delivered as naked RNAs elicited comparable CD8+ T cell responses but the SFV vectors elicited greater humoral responses to an encoded cytoplasmic antigen beta-galactosidase. Studies in MHC class II-deficient mice revealed that neither vector could overcome the dependence of CD4+ T cell help in the development of humoral and cellular responses following immunization. These studies indicate that the distinct biology of the two replicon systems may differentially impact the adaptive immune response and this may need to be considered when designing vaccination strategies. (c) 2005 Elsevier Ltd. All rights reserved.

Glycinergic and GABAergic synaptic activity differentially regulate motoneuron survival and skeletal muscle innervation

GABAergic and glycinergic synaptic transmission is proposed to promote the maturation and refinement of the developing CNS. Here we provide morphological and functional evidence that glycinergic and GABAergic synapses control motoneuron development in a region-specific manner during programmed cell death. In gephyrin-deficient mice that lack all postsynaptic glycine receptor and some GABA(A) receptor clusters, there was increased spontaneous respiratory motor activity, reduced respiratory motoneuron survival, and decreased innervation of the diaphragm. In contrast, limb-innervating motoneurons showed decreased spontaneous activity, increased survival, and increased innervation of their target muscles. Both GABA and glycine increased limb-innervating motoneuron activity and decreased respiratory motoneuron activity in wild-type mice, but only glycine responses were abolished in gephyrin-deficient mice. Our results provide genetic evidence that the development of glycinergic and GABAergic synaptic inputs onto motoneurons plays an important role in the survival, axonal branching, and spontaneous activity of motoneurons in developing mammalian embryos.

Neural progenitor number is regulated by nuclear factor-kappa B p65 and p50 subunit-dependent proliferation rather than cell survival

The number of cells generated by a proliferating stem or precursor cell can be influenced both by proliferation and by the degree of cell death/survival of the progeny generated. In this study, the extent to which cell survival controls progenitor number was examined by comparing the growth characteristics of neurosphere cultures derived from mice lacking genes for the death inducing Bcl-2 homologue Hara Kiri (Hrk), apoptosis-associated protein 1 (Apaf1), or the prosurvival nuclear factor-kappa B (NF kappa B) subunits p65, p50, or c-rel. We found no evidence that Hrk or Apaf1, and by inference the mitochondrial cell death pathway, are involved in regulating the number of neurosphere-derived progeny. However, we identified the p65p50 NF kappa B dimer as being required for the normal growth and expansion of neurosphere cultures. Genetic loss of both p65 and p50 NF kappa B subunits resulted in a reduced number of progeny but an increased proportion of neurons. No effect on cell survival was observed. This suggests that the number and fate of neural progenitor cells are more strongly regulated by cell cycle control than survival. (c) 2005 Wiley-Liss, Inc.