892 resultados para flavour enhancer
Resumo:
We have studied enhancer function in transient and stable expression assays in mammalian cells by using systems that distinguish expressing from nonexpressing cells. When expression is studied in this way, enhancers are found to increase the probability of a construct being active but not the level of expression per template. In stably integrated constructs, large differences in expression level are observed but these are not related to the presence of an enhancer. Together with earlier studies, these results suggest that enhancers act to affect a binary (on/off) switch in transcriptional activity. Although this idea challenges the widely accepted model of enhancer activity, it is consistent with much, if not all, experimental evidence on this subject. We hypothesize that enhancers act to increase the probability of forming a stably active template. When randomly integrated into the genome, enhancers may affect a metastable state of repression/activity, permitting expression in regions that would not permit activity of an isolated promoter.
Resumo:
Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice.
Resumo:
Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression.
Resumo:
Hypoxia-inducible factor 1 (HIF-1) is found in mammalian cells cultured under reduced O2 tension and is necessary for transcriptional activation mediated by the erythropoietin gene enhancer in hypoxic cells. We show that both HIF-1 subunits are basic-helix-loop-helix proteins containing a PAS domain, defined by its presence in the Drosophila Per and Sim proteins and in the mammalian ARNT and AHR proteins. HIF-1 alpha is most closely related to Sim. HIF-1 beta is a series of ARNT gene products, which can thus heterodimerize with either HIF-1 alpha or AHR. HIF-1 alpha and HIF-1 beta (ARNT) RNA and protein levels were induced in cells exposed to 1% O2 and decayed rapidly upon return of the cells to 20% O2, consistent with the role of HIF-1 as a mediator of transcriptional responses to hypoxia.
Resumo:
Genes containing the interferon-stimulated response element (ISRE) enhancer have been characterized as transcriptionally responsive primarily to type I interferons (IFN alpha/beta). Induction is due to activation of a multimeric transcription factor, interferon-stimulated gene factor 3 (ISGF3), which is activated by IFN alpha/beta but not by IFN gamma. We found that ISRE-containing genes were induced by IFN gamma as well as by IFN alpha in Vero cells. The IFN gamma response was dependent on the ISRE and was accentuated by preexposure of cells to IFN alpha, a treatment that increases the abundance of ISGF3 components. Overexpression of ISGF3 polypeptides showed that the IFN gamma response depended on the DNA-binding protein ISGF3 gamma (p48) as well as on the 91-kDa protein STAT91 (Stat1 alpha). The transcriptional response to IFN alpha required the 113-kDa protein STAT113 (Stat2) in addition to STAT91 and p48. Mutant fibrosarcoma cells deficient in each component of ISGF3 were used to confirm that IFN gamma induction of an ISRE reporter required p48 and STAT91, but not STAT113. A complex containing p48 and phosphorylated STAT91 but lacking STAT113 bound the ISRE in vitro. IFN gamma-induced activation of this complex, preferentially formed at high concentrations of p48 and STAT91, may explain some of the overlapping responses to IFN alpha and IFN gamma.
Resumo:
Pemphigus vulgaris (PV) is a rare, potentially fatal, autoimmune disease that affects the skin and mucous membranes. The PV antigen (PVA) has been characterized as desmoglein 3. PV patients carry HLA-DR4- or HLA-DR6-bearing extended haplotypes. We recently demonstrated that patients with active disease have high titers of PV autoantibodies of the IgG1 and IgG4 subclasses. Patients in remission, healthy unaffected relatives, and some MHC-matched normal individuals have low levels of PV autoantibodies, which are IgG1 only. Furthermore, intraperitoneal injection of IgG from patients with active disease caused clinical disease in mice, but IgG from patients in remission, healthy relatives, or MHC-matched normal individuals did not. We prepared 12 peptides of 30 amino acids each (peptides Bos 1-12) spanning the extracellular domain of PVA. Patients with active disease recognize peptides Bos 1 and Bos 6 with high titers of IgG1 and IgG4 autoantibodies. Patients in remission have IgG1 autoantibodies to peptide Bos 1 only, in statistically significantly lower titers (P < 0.01). They no longer have IgG4 subclass autoantibodies to peptide Bos 6. Healthy relatives and normal unrelated individuals have low levels of only IgG1 autoantibodies that recognize only Bos 1. In vitro studies indicate that Bos 6-specific IgG and, to a lesser extent, Bos 1-specific IgG can cause acantholysis. Our data suggest that Bos 6-specific IgG4 is probably the main acantholytic autoantibody, while Bos 1-specific IgG4 may act as a facilitator or enhancer of the process. In this study we illustrate some of the paradigms that demonstrate the interactions between the MHC, subclass of autoantibodies, and peptide specificities of the autoantibodies in the autoimmune process. Thus, PV provides an important model to study the pathogenesis of autoimmunity.
Resumo:
In cell culture, type alpha transforming growth factor (TGF-alpha) stimulates epithelial cell growth, whereas TGF-beta 1 overrides this stimulatory effect and is growth inhibitory. Transgenic mice that overexpress TGF-alpha under control of the mouse mammary tumor virus (MMTV) promoter/enhancer exhibit mammary ductal hyperplasia and stochastic development of mammary carcinomas, a process that can be accelerated by administration of the chemical carcinogen 7,12-dimethylbenz[a]anthracene. MMTV-TGF-beta 1 transgenic mice display mammary ductal hypoplasia and do not develop mammary tumors. We report that in crossbreeding experiments involving the production of mice carrying both the MMTV-TGF-beta 1 and MMTV-TGF-alpha transgenes, there is marked suppression of mammary tumor formation and that MMTV-TGF-beta 1 transgenic mice are resistant to 7,12-dimethylbenz[a]anthracene-induced mammary tumor formation. These data demonstrate that overexpression of TGF-beta 1 in vivo can markedly suppress mammary tumor development.
Resumo:
The abundance of delta-crystallin in the chicken eye lens provides an advantageous marker for tissue-specific gene expression during cellular differentiation. The lens-specific expression of the delta 1-crystallin gene is governed by an enhancer in the third intron, which binds a positive (delta EF2) and negative (delta EF1) factor in its core region. Here we show by DNase I footprinting, electrophoretic mobility-shift assays, and cotransfection experiments with the delta 1-promoter/enhancer fused to the chloramphenicol acetyltransferase reporter gene that the delta 1-crystallin enhancer has two adjacent functional Pax-6 binding sites. We also demonstrate by DNase I footprinting that the delta EF1 site can bind the transcription factor USF, raising the possibility that USF may cooperate with Pax-6 in activation of the chicken delta 1- and alpha A-crystallin genes. These data, coupled with our recent demonstration that Pax-6 activates the alpha A-crystallin gene, suggest that Pax-6 may have been used extensively throughout evolution to recruit and express crystallin genes in the lens.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
The plant growth hormone indole-3-acetic acid (IAA) transcriptionally activates expression of several genes in plants. We have previously identified a 164-bp promoter region (-318 to -154) in the PS-IAA4/5 gene that confers IAA inducibility. Linker-scanning mutagenesis across the region has identified two positive domains: domain A (48 bp; -203 to -156) and domain B (44 bp; -299 to -256), responsible for transcriptional activation of PS-IAA4/5 by IAA. Domain A contains the highly conserved sequence 5'-TGTCCCAT-3' found among various IAA-inducible genes and behaves as the major auxin-responsive element. Domain B functions as an enhancer element which may also contain a less efficient auxin-responsive element. The two domains act cooperatively to stimulate transcription; however, tetramerization of domain A or B compensates for the loss of A or B function. The two domains can also mediate IAA-induced transcription from the heterologous cauliflower mosaic virus 35S promoter (-73 to +1). In vivo competition experiments with icosamers of domain A or B show that the domains interact specifically and with different affinities to low abundance, positive transcription factor(s). A model for transcriptional activation of PS-IAA4/5 by IAA is discussed.
Resumo:
The transcription factor NF-E2 (nuclear factor erythroid 2), interacting via DNA motifs within regulatory regions of several hematopoietic genes, is thought to mediate the enhancer activity of the globin locus control regions. By screening a human fetal liver cDNA library with probes derived from mouse NF-E2, we have isolated a splicing variant of the NF-E2 gene (fNF-E2) that differs in the 5' untranslated region from the previously reported cDNA (aNF-E2). The fNF-E2 isoform is transcribed from an alternative promoter located in the 3' end of the first intron and joined by alternative splicing to the second and third exons, which are shared by both RNA isoforms. Although the two forms produce the same protein, they are expressed in different ratios during development. fNF-E2 is more abundant in the fetal liver and less abundant in the adult bone marrow compared to the previously described form. Their distribution apparently follows the differential expression of fetal and adult hemoglobins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
A inclusão de óleos vegetais na dieta de bovinos tem sido utilizada para aumentar a densidade energética da dieta, melhorar a eficiência alimentar, além de produzir carnes com a composição de ácidos graxos mais favorável à saúde humana. Objetivou-se estudar os efeitos da inclusão de óleos de soja, girassol e linhaça na dieta de bovinos, sobre o desempenho, características quantitativas de carcaça e qualitativas da carne, perfil de ácidos graxos, oxidação lipídica e formação de compostos oxidados do colesterol. Foram confinados 96 bovinos Nelore, castrados, com aproximadamente 380 kg ± 34 kg de peso inicial e idade média de 20 meses. As dietas foram compostas de 79% de concentrado e 21% de volumoso (silagem de milho) e incluídos os óleos de soja, girassol e linhaça. Os animais foram pesados e avaliadas as características de carcaça por ultrassonografia nos dias 0, 28, 56 e 81 de confinamento. Nos dias zero e 81 dias de confinamento foi coletado sangue dos bovinos para avaliação do LDL-colesterol, HDL-colesterol, VLDL-colesterol e triacilgliceróis. Ao final de 81 dias de confinamento, os animais foram abatidos e foi avaliado o pH (uma e 48 horas após o abate) e foram retiradas amostras do músculo longissimus. Foi avaliado a cor, força de cisalhamento (FC) e perdas por cocção (PPC) em carnes não maturadas e maturadas por 14 dias. Duas amostras do longissimus foram expostas por um e três dias em condições semelhantes ao varejo. Nas carnes expostas por um dia foi avaliado a cor e o pH. Nas amostras expostas por três dias foi avaliado além da cor e pH, o perfil de ácidos graxos, TBARS, colesterol e a presença do 7-cetocolesterol. Foi realizada ainda a análise sensorial e determinado a quantidade de lipídios totais das carnes. A estabilidade oxidativa dos óleos utilizados na dieta também foi avaliada. O experimento foi conduzido em delineamento de blocos casualizados, sendo o peso inicial o bloco. O desempenho e as características de carcaça avaliadas por ultrassonografia não foram influenciadas pelas fontes de óleo. Os tratamentos não influenciaram o peso de abate, o peso de carcaça quente, o pH da carcaça uma hora e 48 horas após o abate, o rendimento de carcaça, a cor, as PPC e a FC. O pH foi maior nas carnes maturadas por 14 dias (P=0,01), em relação àquelas sem maturação. As PPC e a FC foram menores (P=0,01) nas carnes maturadas por 14 dias. O óleo de linhaça apresentou menor estabilidade oxidativa seguidos do óleo de girassol e soja. As fontes de óleo não afetaram a concentração dos lipídios do plasma sanguíneo, no entanto, os níveis de VLDL, LDL, HDL, colesterol e triacilgliceróis foram maiores (P<0,01) no final do experimento em relação ao início. Não houve interação entre a espessura de gordura subcutânea (EGS) avaliada no abate e as dietas e efeito das fontes de óleo sobre os valores de TBARS, lipídios e colesterol. Não foi encontrado o 7-cetocolesterol nas carnes. O pH das carnes expostas por um e três dias sob condições de varejo, não foram influenciadas pela dieta nem pela interação da dieta e dos dias de exposição. No entanto, foi observado o efeito de tempo (P<0,01), as carnes expostas por três dias tiveram valores de pH maiores que as carnes expostas por um dia. A cor L*, a* e b* das carnes expostas em gôndola, sob condições de varejo não foi influenciado pela dieta, pelos dias de exposição e nem pela interação dos dias de exposição e dietas. Os ácidos graxos C18:1 n-9, C20:3 n-6 e C20:5 n-3 apresentaram interação entre a EGS e a dieta (P<0,05). O C18:1 cis 6 apresentou maiores concentrações (P<0,05) nas carnes provenientes dos animais alimentados com óleo de linhaça e soja, em comparação com as carnes provenientes da dieta controle. O C18:3 n-3 apresentou maiores concentrações nas carnes de animais alimentados com linhaça (P<0,05), em comparação com os demais tratamentos. O aroma e a textura da carne avaliados em análise sensorial realizada com consumidores não foram alterados pelos tratamentos. A carne dos animais alimentados com óleo de girassol resultou em maiores notas para o sabor (P<0,01), em relação à carne proveniente de animais alimentados com óleo de soja. As dietas controle e girassol resultaram em carnes mais suculentas e com maior aceitabilidade global (P<0,01), em relação ao tratamento soja. Independentemente do tipo de óleo utilizado na dieta dos animais, não houve influência no desempenho e nas características da carcaça. O óleo de linhaça proporcionou carnes com perfil de ácidos graxos mais favorável para a saúde humana, pois apresentou maiores proporções do ácido linolênico e relações ideais de n6:n3 (4,15). O uso de óleos vegetais na dieta, não prejudicou a aparência das carnes e não proporcionaram oxidação lipídica com a formação de compostos de colesterol oxidados nas carnes expostas sob condições de varejo.
Resumo:
From the Introduction. The present contribution is an attempt to raise awareness between the 'trenches' by juxtaposing the two approaches to subsidiarity. Subsequently, I shall set out why, in economics, subsidiarity is embraced as a key principle in the design and working of the Union and how a functional subsidiarity test can be derived from this thinking. Throughout the paper, a range of illustrations and examples is provided in an attempt to show the practical applicability of a subsidiarity test. This does not mean, of course, that the application of the test can automatically "solve" all debates on whether subsidiarity is (not) violated. What it does mean, however, is that a careful methodology can be a significant help to e.g. national parliaments and the Brussels circuit, in particular, to discourage careless politicisation as much as possible and to render assessments of subsidiarity comparable throughout the Union. The latter virtue should be of interest to national parliaments in cooperating, within just six weeks, about a common stance in the case of a suspected violation of the principle. The structure of the paper is as follows. Section 2 gives a flavour of very different approaches and appreciation of the subsidiarity principle in European law and in the economics of multi-tier government. Section 3 elaborates on the economics of multi-tier government as a special instance of cost / benefit analysis of (de)centralisation in the three public economic functions of any government system. This culminates in a five-steps subsidiarity test and a brief discussion about its proper and improper application. Section 4 applies the test in a non-technical fashion to a range of issues of the "efficiency function" (i.e. allocation and markets) of the EU. After showing that the functional logic of subsidiarity may require liberalisation to be accompanied by various degrees of centralisation, a number of fairly detailed illustrations of how to deal with subsidiarity in the EU is provided. One illustration is about how the subsidiarity logic is misused by protagonists (labour in the internal market). A slightly different but frequently encountered aspect consists in the refusal to recognize that the EU (that is, some form of centralisation) offers a better solution than 25 national ones. A third range of issues, where the functional logic of subsidiarity could be useful, emerges when the boundaries of national competences are shifting due to more intense cross-border flows and developments. Other subsections are devoted to Union public goods and to the question whether the subsidiarity test might trace instances of EU decentralisation: a partial or complete shift of a policy or regulation to Member States. The paper refrains from an analysis of the application of the subsidiarity test to the other two public functions, namely, equity and macro-economic stabilisation.2 Section 5 argues that the use of a well-developed methodology of a functional subsidiarity test would be most useful for the national parliaments and even more so for their cooperation in case of a suspected violation of subsidiarity. Section 6 concludes.
Resumo:
Formation of the vertebrate axial skeleton requires coordinated Hox gene activity. Hox group 6 genes are involved in the formation of the thoracic area owing to their unique rib-promoting properties. Here we show that the linker region (LR) connecting the homeodomain and the hexapeptide is essential for Hoxb6 rib-promoting activity in mice. The LR-defective Hoxb6 protein was still able to bind a target enhancer together with Pax3, producing a dominant-negative effect, indicating that the LR brings additional regulatory factors to target DNA elements. We also found an unexpected association between Hoxb6 and segmentation in the paraxial mesoderm. In particular, Hoxb6 can disturb somitogenesis and anterior-posterior somite patterning by dysregulation of Lfng expression. Interestingly, this interaction occurred differently in thoracic versus more caudal embryonic areas, indicating functional differences in somitogenesis before and after the trunk-to-tail transition. Our results suggest the requirement of precisely regulated Hoxb6 expression for proper segmentation at tailbud stages.