Positiones philosophicae ex fragrantissimo philosophiae viridario carptìm collectae. Quas ex consensu amplissimae [et] venerandae facultatis philosophicae in Regiâ Academiâ Aboënsi. Sub praesidio, ... dn. Michaelis Gyllenstålpes, Wexionii, j. u. & philos: doct: pereximii, ll:m polit: & hist: prof: publ: celeberrimi, p. t. rectoris magnifici, moecenatis, praecept. ac promotoris quovis obsequii & honoris genere plurimùm prosequendi. Liberalis exercitij gratia, publicae eruditorum disquisitioni modestè sistit Daniel B. Rosander Smolandus s. r. m.tis stipendiarius. In auditorio majori ad diem 22. Novemb. anno 1654. Horis ab 8. antemeridianis

Variantti A.

The use of genes for performance enhancement: doping or therapy?

Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM) to enhance athletic performance. In such ‘gene doping’, exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO), vascular endothelial growth factor (VEGF), insulin-like growth factor type 1 (IGF-1), myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products) in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.

De Sveo-Gothis; qui vixerunt sub periodo Erici I.mi. ad Ericum 2.dum: memorans quomodo restituti sunt primum ab Erico, mox tamen ac multos annos ab incertis ducibus vexati, at nunquam vera religione destituti

Variantti B.

De Sveo-Gothis; qui vixerunt sub periodo Erici I.mi. ad Ericum 2.dum: memorans quomodo restituti sunt primum ab Erico, mox tamen ac multos annos ab incertis ducibus vexati, at nunquam vera religione destituti

Variantti A.

De Sveo-Gothis, qui vixerunt sub finem Testamenti Veteris, post praemissa nonnulla de Biarmorum Jumala, expendens quomodo hic verus Deus et Sathanam tunc strinxit circa religionis curam apud paganos, et sibi quosdam alios servavit pios adminiculis variis auctos

Variantti B.

Linea omnes dati generis determinato sub angulo secans in spatio trium dimensionum investigans

Dedikaatio: Fredrika Wilhelmina Stjernvall född Charpentier [ruots.].

Myosin light chain kinase is necessary for post-shock mesenteric lymph drainage enhancement of vascular reactivity and calcium sensitivity in hemorrhagic-shocked rats

Vascular hyporeactivity is an important factor in irreversible shock, and post-shock mesenteric lymph (PSML) blockade improves vascular reactivity after hemorrhagic shock. This study explored the possible involvement of myosin light chain kinase (MLCK) in PSML-mediated vascular hyporeactivity and calcium desensitization. Rats were divided into sham (n=12), shock (n=18), and shock+drainage (n=18) groups. A hemorrhagic shock model (40±2 mmHg, 3 h) was established in the shock and shock+drainage groups. PSML drainage was performed from 1 to 3 h from start of hypotension in shock+drainage rats. Levels of phospho-MLCK (p-MLCK) were determined in superior mesenteric artery (SMA) tissue, and the vascular reactivity to norepinephrine (NE) and sensitivity to Ca2+ were observed in SMA rings in an isolated organ perfusion system. p-MLCK was significantly decreased in the shock group compared with the sham group, but increased in the shock+drainage group compared with the shock group. Substance P (1 nM), an agonist of MLCK, significantly elevated the decreased contractile response of SMA rings to both NE and Ca2+ at various concentrations. Maximum contractility (Emax) in the shock group increased with NE (from 0.179±0.038 to 0.440±0.177 g/mg, P<0.05) and Ca2+ (from 0.515±0.043 to 0.646±0.096 g/mg, P<0.05). ML-7 (0.1 nM), an inhibitor of MLCK, reduced the increased vascular response to NE and Ca2+ at various concentrations in the shock+drainage group (from 0.744±0.187 to 0.570±0.143 g/mg in Emax for NE and from 0.729±0.037 to 0.645±0.056 g/mg in Emax for Ca2+, P<0.05). We conclude that MLCK is an important contributor to PSML drainage, enhancing vascular reactivity and calcium sensitivity in rats with hemorrhagic shock.

Observationes nonnullae super naturam phrenoshematum [!]. Qvas consentiente ampliss: facultate philosophica in Regia Academia Aboënsi, sub praesidio, ... dn. Torst. Rudeen, poës. profess. ord. h. t. facult. phil. decani spectabilis, publici speciminis loco bonis examinandas modestè exhibet Jonas Emzeen, Wermel: ad d. 30 Aprilis anni 1697 loco [et] horis adsuetis

Variantti B.

Nova ratione determinantur loca telluris, ab effectibus parallaxis in transitu planetarum sub sole, dependentia

Arkit: A-B4.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

De lingvis sub imperio Sveo-Gothico usitatioribus

Invokaatio: Favente Jehovâ.

Organization of the marketing communication activities after fusion - the integration and the decision making processes

This master’s thesis was made in order to gain answers to the question of how the integration of the marketing communications and the decision making related to it in a geographically dispersed service organization could be improved in a situation where an organization has gone through a merger. The effects of the organizational design dimensions towards the integration of the marketing communications and the decision making related to it was the main focus. A case study as a research strategy offered a perfect frames for an exploratory study and the data collection was conducted by semi-structured interviews and observing. The main finding proved that from the chosen design dimensions, decentralization, coordination and power, could be found specific factors that in a geographically dispersed organization are affecting the integration of the marketing communications negatively. The effects can be seen mostly in the decision making processes, roles and in the division of responsibility, which are affecting the other dimensions and by this, the integration. In a post-merger situation, the coordination dimension and especially the information asymmetry and the information flow seem to have a largest affect towards the integration of the marketing communications. An asymmetric information distribution with the lack of business and marketing education resulted in low self-assurance and at the end in fragmented management and to the inability to set targets and make independent decisions. As conclusions it can be stated, that with the organizational design dimensions can the effects of a merger towards the integration process of the marketing communications to be evaluated.

Weldability of powder bed fusion fabricated stainless steel 316L sheets to cold rolled sheet metal

Weldability of powder bed fusion (PBF) fabricated components has come to discussion in past two years due to resent developments in the PBF technology and limited size of the machines used in the fabrication process. This study concentrated on effects of energy input of welding on mechanical properties and microstructural features of welds between PBF fabricated stainless steel 316L sheets and cold rolled sheet metal of same composition by the means of destructive testing and microscopic analysis. Optical fiber diameter, laser power and welding speed were varied during the experiments that were executed following one variable at a time (OVAT) method. One of the problems of welded PBF fabricated components has been lower elongations at break comparing to conventionally manufactured components. Decreasing energy input of the laser keyhole welding decreased elongations at break of the welded specimens. Ultimate tensile strengths were not affected significantly by the energy input of the welding, but fracturing of the specimens welded using high energy input occurred from the weld metal. Fracturing of the lower energy input welds occurred from the PBF fabricated base metal. Energy input was found to be critical factor for mechanical properties of the welds. Multioriented grain growth and formation of neck at fusion zone boundary on the cold rolled side of the weld was detected and suspected to be result from weld pool flows caused by differences in molten weld pool behaviour between the PBF fabricated and cold rolled sides of the welds.

Functionalisation of spruce O-acetyl-galactoglucomannans for barrier and composite applications

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.