993 resultados para Normal uptake


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple sclerosis (MS) is a chronic autoimmune disease of the central nervous system CNS), where inflammation and neurodegeneration lead to irreversible neuronal damage. In MS, a dysfunctional immune system causes auto‐reactive lymphocytes to migrate into CNS where they initiate an inflammatory cascade leading to focal demyelination, axonal degeneration and neuronal loss. One of the hallmarks of neuronal injury and neuroinflammation is the activation of microglia. Activated microglia are found not only in the focal inflammatory lesions, but also diffusely in the normal‐appearing white matter (NAWM), especially in progressive MS. The purine base, adenosine is a ubiquitous neuromodulator in the CNS and also participates in the regulation of inflammation. The effect of adenosine mediated via adenosine A2A receptors has been linked to microglial activation, whereas modulating A2A receptors may exert neuroprotective effects. In the majority of patients, MS presents with a relapsing disease course, later advancing to a progressive phase characterised by a worsening, irreversible disability. Disease modifying treatments can reduce the severity and progression in relapsing MS, but no efficient treatment exists for progressive MS. The aim of this research was to investigate the prevalence of adenosine A2A receptors and activated microglia in progressive MS by using in vivo positron emission tomography (PET) imaging and [11C]TMSX and [11C](R)‐PK11195 radioligands. Magnetic resonance imaging (MRI) with diffusion tensor imaging (DTI) was performed to evaluate structural brain damage. Non‐invasive input function methods were also developed for the analyses of [11C]TMSX PET data. Finally, histopathological correlates of [11C](R)‐PK11195 radioligand binding related to chronic MS lesions were investigated in post‐mortem samples of progressive MS brain using autoradiography and immunohistochemistry. [11C]TMSX binding to A2A receptors was increased in NAWM of secondary progressive MS (SPMS) patients when compared to healthy controls, and this correlated to more severe atrophy in MRI and white matter disintegration (reduced fractional anisotropy, FA) in DTI. The non‐invasive input function methods appeared as feasible options for brain [11C]TMSX images obviating arterial blood sampling. [11C](R)‐PK11195 uptake was increased in the NAWM of SPMS patients when compared to patients with relapsing MS and healthy controls. Higher [11C](R)‐PK11195 binding in NAWM and total perilesional area of T1 hypointense lesions was associated with more severe clinical disability, increased brain atrophy, higher lesion load and reduced FA in NAWM in the MS patients. In autoradiography, increased perilesional [11C](R)‐PK11195 uptake was associated with increased microglial activation identified using immunohistochemistry. In conclusion, brain [11C]TMSX PET imaging holds promise in the evaluation of diffuse neuroinflammation in progressive MS. Being a marker of microglial activation, [11C](R)‐ PK11195 PET imaging could possibly be used as a surrogate biomarker in the evaluation of the neuroinflammatory burden and clinical disease severity in progressive MS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phosphatidylserine (PS) exposure occurs during the cell death program and fluorescein-labeled lactadherin permits the detection of PS exposure earlier than annexin V in suspended cell lines. Adherent cell lines were studied for this apoptosis-associated phenomenon to determine if PS probing methods are reliable because specific membrane damage may occur during harvesting. Apoptosis was induced in the human tongue squamous carcinoma cell line (Tca8113) and the adenoid cystic carcinoma cell line (ACC-2) by arsenic trioxide. Cells were harvested with a modified procedure and labeled with lactadherin and/or annexin V. PS exposure was localized by confocal microscopy and apoptosis was quantified by flow cytometry. The detachment procedure without trypsinization did not induce cell damage. In competition binding experiments, phospholipid vesicles competed for more than 95 and 90% of lactadherin but only about 75 and 70% of annexin V binding to Tca8113 and ACC-2 cells. These data indicate that PS exposure occurs in three stages during the cell death program and that fluorescein-labeled lactadherin permitted the detection of early PS exposure. A similar pattern of PS exposure has been observed in two malignant cell lines with different adherence, suggesting that this pattern of PS exposure is common in adherent cells. Both lactadherin and annexin V could be used in adherent Tca8113 and ACC-2 cell lines when an appropriate harvesting procedure was used. Lactadherin is more sensitive than annexin V for the detection of PS exposure as the physical structure of PS in these blebs and condensed apoptotic cell surface may be more conducive to binding lactadherin than annexin V.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ) of oxygen consumption ( O2) and the applied power output (work rate = WR) during ramp-incremental exercise in patients with mitochondrial myopathy (MM). Fourteen patients (7 males, age 35.4 ± 10.8 years) with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years) took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT) and the gas exchange threshold (GET). The ΔO2/ΔWR slope was calculated up to GET (S1), above GET (S2) and over the entire linear portion of the response (S T). Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P < 0.05). Patients had significantly lower ΔO2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P < 0.001). There were significant relationships between ΔO2/ΔWR (S T) and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P < 0.05). In fact, all patients with ΔO2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (<60% predicted). Moreover, patients with higher cardiopulmonary stresses during exercise (e.g., higher Δ ventilation/carbon dioxide output and Δ heart rate/ΔO2) had lower ΔO2/ΔWR (P < 0.05). In conclusion, a readily available, effort-independent index of aerobic dysfunction during dynamic exercise (ΔO2/ΔWR) is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

18F-fluoro-2-deoxyglucose (FDG) positron emission tomography (PET)/computed tomography (CT) is widely used to diagnose and stage non-small cell lung cancer (NSCLC). The aim of this retrospective study was to evaluate the predictive ability of different FDG standardized uptake values (SUVs) in 74 patients with newly diagnosed NSCLC. 18F-FDG PET/CT scans were performed and different SUV parameters (SUVmax, SUVavg, SUVT/L, and SUVT/A) obtained, and their relationship with clinical characteristics were investigated. Meanwhile, correlation and multiple stepwise regression analyses were performed to determine the primary predictor of SUVs for NSCLC. Age, gender, and tumor size significantly affected SUV parameters. The mean SUVs of squamous cell carcinoma were higher than those of adenocarcinoma. Poorly differentiated tumors exhibited higher SUVs than well-differentiated ones. Further analyses based on the pathologic type revealed that the SUVmax, SUVavg, and SUVT/L of poorly differentiated adenocarcinoma tumors were higher than those of moderately or well-differentiated tumors. Among these four SUV parameters, SUVT/Lwas the primary predictor for tumor differentiation. However, in adenocarcinoma, SUVmax was the determining factor for tumor differentiation. Our results showed that these four SUV parameters had predictive significance related to NSCLC tumor differentiation; SUVT/L appeared to be most useful overall, but SUVmax was the best index for adenocarcinoma tumor differentiation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The oxygen uptake efficiency slope (OUES) is a submaximal index incorporating cardiovascular, peripheral, and pulmonary factors that determine the ventilatory response to exercise. The purpose of this study was to evaluate the effects of continuous exercise training and interval exercise training on the OUES in patients with coronary artery disease. Thirty-five patients (59.3±1.8 years old; 28 men, 7 women) with coronary artery disease were randomly divided into two groups: continuous exercise training (n=18) and interval exercise training (n=17). All patients performed graded exercise tests with respiratory gas analysis before and 3 months after the exercise-training program to determine ventilatory anaerobic threshold (VAT), respiratory compensation point, and peak oxygen consumption (peak VO2). The OUES was assessed based on data from the second minute of exercise until exhaustion by calculating the slope of the linear relation between oxygen uptake and the logarithm of total ventilation. After the interventions, both groups showed increased aerobic fitness (P<0.05). In addition, both the continuous exercise and interval exercise training groups demonstrated an increase in OUES (P<0.05). Significant associations were observed in both groups: 1) continuous exercise training (OUES and peak VO2 r=0.57; OUES and VO2 VAT r=0.57); 2) interval exercise training (OUES and peak VO2 r=0.80; OUES and VO2 VAT r=0.67). Continuous and interval exercise training resulted in a similar increase in OUES among patients with coronary artery disease. These findings suggest that improvements in OUES among CAD patients after aerobic exercise training may be dependent on peripheral and central mechanisms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.