Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação de cultivares de arroz de terras altas sob condições de sequeiro em Cassilândia, MS

O uso de cultivares selecionadas é uma das tecnologias de mais fácil adoção pelo agricultor, pois além de incrementar a produtividade, é um dos insumos de menor custo na produção agrícola. Assim, é fundamental obter informações sobre o desempenho de novas cultivares, nas mais diversas regiões de cultivo. Objetivou-se, neste trabalho avaliar o comportamento de cultivares de arroz de terras altas (Oryza sativa L.) (BRS Aroma, BRS Bonança, BRS Colosso, BRSMG Conai, BRSMG Curinga, BRS Soberana, BRS Talento e IAC 202), sob condições de sequeiro, na região de Cassilândia, MS. O delineamento experimental foi o de blocos ao acaso, com quatro repetições. A semeadura foi realizada em 30 de novembro de 2005, no espaçamento de 0,40 m entre linhas e 70 sementes viáveis por metro. As cultivares BRS Talento, IAC 202 e BRS Soberana apresentaram comportamento superior. As cultivares BRS Soberana, BRS Bonança, BRS Colosso, IAC 202 e BRS Talento apresentaram maior rendimento de grãos inteiros. É possível obterse boa produtividade (acima de 3.000 kg ha-1), na cultura do arroz de terras altas sob condições de sequeiro no município de Cassilândia, MS, desde que sejam utilizadas cultivares adequadas.

Nutrição do milho e da Brachiaria decumbens cultivados em consórcio em diferentes preparos do solo

O objetivo deste trabalho foi avaliar sistemas de consorciação entre milho e Brachiaria decumbens e seus efeitos sobre a nutrição mineral das culturas. O experimento foi conduzido no ano agrícola de 2005, na Área Experimental do Campus Delza Gitaí, pertencente ao CECA-UFAL. Os tratamentos consistiram do cultivo de um híbrido de milho BRS 3150, nos sistemas: Preparo Convencional do Solo, Cultivo Mínimo e Semeadura Direta (BRS 3150 em consórcio com Brachiaria decumbens). O experimento obedeceu ao esquema de blocos casualisados com parcelas subdivididas em quatro repetições. Durante o período de florescimento da cultura do milho, foram coletadas folhas da base da espiga para análise nutricional. Foram realizadas coletas de material vegetal da Brachiaria decumbens em quatro épocas para determinação de massa seca; para análise nutricional, utilizou-se material vegetal proveniente da terceira coleta. Pôde-se observar que a presença da Brachiaria decumbens não interferiu na nutrição mineral da cultura do milho; o efeito residual da adubação realizada para cultura do milho beneficiou a Brachiaria decumbens, elevando seu valor nutritivo; a Brachiaria decumbens teve seu crescimento limitado, quando cultivada em consórcio, devido ao efeito do sombreamento proporcionado pela cultura do milho.

Grapevine bacterial canker in the State of São Paulo, Brazil: detection and eradication

Sintomas do cancro bacteriano da videira na variedade Red Globe foram observados em agosto de 2009 em pomar de Tupi Paulista, Estado de São Paulo, Brasil, e o agente causal Xanthomonas campestris pv. viticola foi identificado por meio de testes patológicos e moleculares. O procedimento de erradicação foi adotado e aproximadamente 4.700 plantas foram destruídas. Um levantamento realizado nas regiões produtoras do Estado de São Paulo não encontrou nenhum outro pomar contaminado, e essa espécie bacteriana é considerada ausente neste estado.

Atratividade de genótipos de feijão-caupi para oviposição de Bemisia tabaci biótipo B

O objetivo deste trabalho foi avaliar a atratividade de genótipos de feijão-caupi para oviposição de Bemisia tabaci biótipo B e identificar possíveis fontes de resistência à mosca-branca. Foram avaliados 51 genótipos, com uso de testes de chance de escolha. Os genótipos foram divididos aleatoriamente em dois grupos, tendo-se utilizado o genótipo Canapu como testemunha sucetível. Os 14 genótipos mais promissores (sete de cada grupo) foram selecionados para a realização de ensaios complementares (com ou sem chance de escolha). No teste com chance de escolha, os genótipos BRS-Urubuquara, TVU-36, TE93-244-23 F-1, BR 17-Gurgueia, BRS-Marataoã, MNC99-541 F-21 e TE97-304 G-4 foram menos atrativos à mosca-branca. Os genótipos TE93-244-23 F-1 e TVU-36 apresentaram resistência pelo mecanismo de não preferência para ovoposição. No teste sem chance de escolha, apenas o genótipo TVU-36 apresentou resistência por esse mecanismo.

Impactos do estresse salino e da cobertura morta nas características químicas do solo e no desenvolvimento do amaranto

Availability of good quality water has been reduced vertiginously, over the last decade, in the world. In some regions, the water resources have high concentration of the dissolved salts, these characteristics of the water make it s use impossible. Water quality can be a limitation for irrigated agriculture, principally in regions of arid or semiarid climate where the water resources are generally saline and are exposed at high evaporation ratio. For that reason, precipitation of the salts occurs near the soil surface and those salts themselves cumulate in the vegetal tissue, reducing the soil fertility and crop production. The adoption of tolerant crop to the water salinity and soil salinity, adaptable to the climatic conditions is other emergent necessity. This work had the goal of studying the effects of four salinity levels of the irrigation water salinity and use of mulch, dried leaves of Forest mangrove (Acacia mangiumWilld), in cultivated soil with amaranth (Amaranthus cruentus, BRS Alegria variety), in greenhouse. It was utilized the transplant of plants to PVC columns, containing 30 kg of silty loam soil, 10 days after emerging, with space of 50 x 50 cm between lines. Treatments were composed by combination of four levels of salinity (0.147; 1.500; 3.000 e 4.500 dS m-1), obtained by addition NaCl (commercial) to irrigation water and soil with and without protection, by mulch. A factorial system 4 x 2 was used with four repetitions, totalizing 32 parcels. The concentrations of nutrients in soil solution have been evaluated, in the dry matter of the vegetal tissue (roots, stem, leaves and raceme residue), at the end of the vegetative cycle. The use of soil protection reduced time for the beginning inflorescence of plants, at the same time, the increase of the salinity delayed this phase of amaranth development. The use of the mulch effectively increased the height, stem diameter, area of the larger leaf, humidity and dry matter content and amaranth grain production. The vegetal species showed salinity tolerance to experimented levels. The adopted treatments did not affect the pH values, exchangeable cation contents, electrical conductivity of soil solution (EC1:5) and saturated extract (ECSE), and Ca+2, Mg+, Fe+2 and Mn+2 contents, in the soil solution. The increase of the salinity concentration in the irrigation water inhibited the mineralization process of the organic matter (OM) and, consequently, the efficiency in the it´s utilization by plants, at the same time, produced increase in the values of the exchangeable sodium percentage (ESP), sodium adsorption ratio (SAR) and potassium adsorption ratio (PAR), in the soil solution. Therefore, the use of the mulch did not affect the first three parameters. The protein and nutrient contents: K+, Ca+2, P, Mg+2 e Cu+2, in amaranth grains, were improved by tillage condition. The raceme residues showed chemical/nutritional composition that makes advantageous its application in animal ration. In this context, it follows that amaranth tolerate the saline stress, of the irrigation water, until 4.500 dS m-1, temperature and relative humidity of the air predominant in the experimental environment

Avaliação do potencial fitorremediador da mamona (Ricinus communis L.) e girassol (Helianthus annuus L.) quanto à remoção de chumbo e tolueno em efluentes sintéticos.

The development of research that aim to reduce or even eliminate the environmental impacts provided by anthropogenic actions. One of these main action is the discard of industrial waste in the biotic compartments such as soil, water and air, gained more space in academic settings and in private. A technique of phytoremediation involving the use of plants (trees, shrubs, creepers and aquatic) and their associated microorganisms in order to remove, degrade or isolate toxic substances to the environment. This study aimed to evaluate the potential for phytoremediation of castor bean (Ricinus communis L.) and sunflower (Helianthus annuus L.), wild crops suitable region of Rio Grande do Norte, to reduce concentrations of lead and toluene present in synthetic wastewater that simulate the characteristics of treated water production originated in the petrochemical Guamaré. The experiment was accomplished in randomized blocks in four replicates. Seeds of BRS Energy for the development of seedlings of castor beans and sunflower for Catissol 01, both provided by EMPARN (Empresa de Pesquisa Agropecuária do Rio Grande do Norte) were used. Lead concentrations tested were 250, 500 and 1000 mg/L called T2, T3 and T4, respectively, for toluene the concentrations used were 125, 256 and 501 μg/L, called T5, T6 and T7, respectively. The data for removal of lead in relation to sewage systems applied in castor bean and sunflower were 43.89 and 51.85% (T2), 73.60 and 73.74% (T3) and 85.66 and 87.80 % (T4), respectively, and toluene were approximately 52.12 and 25.54% (T5), 55.10 and 58.05% (T6) and 79.77 and 74.76% (T7) for castor and sunflower seeds, respectively. From the data obtained, it can be deduce that mechanisms involved in reducing the contaminants were of phytoextraction, in relation to lead and phytodegradation for toluene. However, it can be concluded that the castor bean and sunflower crops can be used in exhaust after-treatment of industrial effluents that have this type of contaminant

Interação silício e alumínio em plantas de arroz de terras altas cultivadas em solo alumínico

Solos com altos teores de Al tóxico podem causar diversos danos às plantas e, como consequência, diminuir sua produtividade; assim, seu manejo torna-se imprescindível para obter maiores produtividades, e o Si pode ser alternativa para diminuir a toxidez por Al em plantas. O objetivo deste trabalho foi avaliar a interação entre Si e Al em plantas de arroz de terras altas cultivadas em solo naturalmente alumínico de textura média arenosa. O delineamento experimental utilizado foi o de blocos inteiramente casualizados, dispostos em esquema fatorial 2 x 5 com quatro repetições. Os tratamentos empregados foram dois cultivares de arroz de terras altas: BRS Talento (não tolerante ao Al, moderno) e Guarani (tolerante ao Al3+, tradicional), além de cinco doses de Si (0, 30, 60, 90 e 120 mg dm-3) adicionadas ao solo. O Si fornecido ao solo contribuiu amenizando a toxidez por Al em ambos os cultivares, porém só houve acréscimo em produtividade no cultivar BRS Talento. Houve correlação positiva para produtividade de grãos do cultivar BRS Talento e teor de Si nas folhas; já o teor de Al nas folhas correlacionou-se com a produtividade de forma negativa; e também houve correlação negativa entre os teores de Si e Al nas folhas, indicando que há interação entre Si e Al em plantas de arroz.

A poesia ibero-americana de José de Anchieta

El poeta José de Anchieta, a través de sus poesías, contribuyó para la formación de la literatura en suelo brasileño. Con eso, él proporcionó un encuentro entre los dos mundos lo Nuevo y lo Viejo, América y Europa representados en la unión entre los pares antagónicos que son constantes en la poética anchietana, como lo sagrado y lo profano, la muerte y la vida, lo simple y lo erudito. Su poética traduce, por lo tanto, las huellas de la antropofagia cultural, en que el indio y el blanco son uno sólo; el pagano y el cristiano, juntos, caminan para el centro de sus ideologías concebidas por la catequesis y por el popular. En esa amalgama entre las culturas, él construye un nuevo código cultural-lingüístico-literario, formando una nueva identidad para la tierra brasileña, abriendo las puertas para el barroco. Sus poemas están en cuatro lenguas: portugués, tupí, latín y español. Y de ese conjunto, nuestra disertación analiza el corpus en lengua española, que en el suelo americano deja de ser española y se vuelve ibero-americana. Como fuentes de estudio crítico-teórico, nos basamos, como ejemplos, en las obras de Haroldo de Campos, Severo Sarduy, Eugênio D Ors, Lezama Lima, Oswald de Andrade, Alfredo Bosi, Massaud Moisés. Así, esta disertación muestra, por el medio de la poesía iberoamericana de José de Anchieta el rasgo del inicio de nuestra literatura así como del barroco americano y, además, conjuga su poesía dentro del espacio de los Clásicos una vez que se comunica con estos desde el proceso de su producción. En esa intercomunicación, José de Anchieta promueve una apertura para la consciencia poética que hace parte de los grandes poetas de la Literatura Universal. Él une el Brasil, con sus matas vírgenes, con su primitivismo, al Mundo, con su censura desmedida ante la visión del Paraíso

Raman and photoluminescence of Er3+-doped SnO2 obtained via the sol-gel technique from solutions with distinct pH

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Rare earth centers properties and electron trapping in SnO2 thin films produced by sol-gel route

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Photoluminescence of Eu(3+) ion in SnO(2) obtained by sol-gel

Photoluminescence data of Eu-doped SnO(2) xerogels are presented, yielding information on the symmetry of Eu(3+) luminescent centers, which can be related to their location in the matrix: at lattice sites, substituting to Sn(4+), or segregated at particles surface. Influence of doping concentration and/or particle size on the photoluminescence spectra obtained by energy transfer from the matrix to Eu(3+) sites is investigated. Results show that a better efficiency in the energy transfer processes is obtained for high symmetry Eu(3+) sites and low doping levels. Emission intensity from (5)D(0) -> (7)F(1) transition increases as the temperature is raised from 10 to 240 K, under excitation at 266 nm laser line, because in this transition the multiphonon emission becomes significant only above 240 K. As an extension of this result, we predict high effectiveness for room temperature operation of Eu-based optical communication devices. X-ray diffraction data show that the impurity excess inhibits particle growth, which may influence the asymmetry ratio of luminescence spectra.

Two-colour photocurrent detection technique for coherent control of a single InGaAs/GaAs quantum dot

We present a two-colour photocurrent detection method for coherent control of a single InGaAs/GaAs self-assembled quantum dot. A pulse shaping technique provides a high degree of control over picosecond optical pulses. Rabi rotations on the exciton to biexciton transition are presented, and fine structure beating is detected via time-resolved measurements. (c) 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Towards coherent optical control of a single hole spin: Rabi rotation of a trion conditional on the spin state of the hole

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Qualidade fisiológica de sementes de genótipos de algodoeiro sob estresse salino

The germination of cotton seeds and the seedlings emergency are generally delayed and reduced by the salinity. Although the cotton is considered a tolerant culture, it can suffer substantial reductions in regarding its growth and production when exposed to salinity condition. The aims of this study went evaluate the effect of the saline stress in the germination phase to four cotton genotypes (BRS Rubi, BRS Safira, BRS 201 and CNPA 187 8H), using different osmotic potentials generated with increment of sodium chloride (NaCl). The saline stress was simulated using NaCl aqueous solutions in the potentials: 0.0 (Control); -0.2; -0.4; -0.6; -0.8 and -1.0 MPa. The treatments were monitored by means of tests for analysis of seeds, germination, first counting, speed germination index, length of shoot, radicle length, dry weigth of embrionic axis and shoot/radicle ratio. The tests for germination, first counting and index of germination speed were accomplished using 50 seeds for repetition and for the study of length of shoot, radicle length, dry weigth of embrionic axis and shoot/radicle ratio were used 20 seeds by repetition. For both tests four repetitions were accomplished by genotype for each one of the potentials. The seeds of each repetition were involved in papers Germitest humidified with NaCl solution corresponding to the potential. The repetitions of both tests were maintained in a germinator with saturated humidity. The analysis were initiate four days after the induction of the saline stress. The evaluations of the first three variables analyzed were accomplished daily; the seeds were remove and counted when its germinated. For the length tests just the repetitions corresponding to the potential of NaCl 0,0 MPa were analysis 4 days after the beginning of the induction of the saline stress. The analysis of the repetitions of the potentials -0,2 and -0,4 and of the potentials -0,6, -0,8 and -1,0 MPa they were accomplished with 12 and 20 days, respectively. For accomplishment of the analisis of this test the shoot of the 20 plantules of each repetition was separate from the radicle and both parts were measured. The statistical analyses were performed using the GENMOD and GLM procedures of the SAS. For the variable germination, the cultivates CNPA 187 8H and BRS Safira stood out for the potential -0.8 MPa, with averages of 89% and 81%, respectively. The test of speed germination index to cultivate BRS Safira presented the largest averages for the two higher saline potentials. It was observed that the increase of the saline potential reduces the germination percentage and speed germination index. For each day of evaluation it was verified that the increase of the saline potential causes a reduction of the length both of the shoot and of the radicle. The radicle tends to grow more than the shoot until the potential -0,4 MPa