972 resultados para spatial temperature gradient capillary electrophoresis
Resumo:
A liga Al-6%Cu foi solidificada direcionalmente sob condições transitórias de extração de calor e microestruturas dendríticas, variáveis térmicas de solidificação, ou seja, velocidade de deslocamento da isoterma líquidus (VL), taxa de resfriamento (TR) e gradiente de temperatura à frente da isoterma liquidus (GL) foram caracterizadas, determinadas experimentalmente e correlacionadas com os espaçamentos dentríticos terciários (λ3). Para tanto, foi projetado, construído e aferido um dispositivo de solidificação direcional horizontal. Os resultados encontrados mostram que leis de potência -1,1 e -0,55 caracterizam a variação dos espaçamentos terciários com a velocidade de deslocamento da isoterma liquidus (VL) e a taxa de resfriamento (TR), respectivamente. Finalmente, é realizado um estudo comparativo entre os resultados obtidos neste trabalho e aqueles publicados na literatura para ligas Al-Cu solidificadas direcionalmente sob condições transientes de fluxo de calor nos sistemas verticais ascendente e descendente.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Aperfeiçoamento em equipamento para digestão de amostras por via úmida. É descrito um aperfeiçoamento em equipamento para digestão de amostras por via úmida que emprega tubos de digestão (20) fechados não encapsulados e aquecimento condutivo que possibilita a rápida decomposição de amostras botânicas, alimentícias, clínicas, ambientais e similares, promovendo um gradiente de temperatura em direção à parte superior do tubo de digestão, permitindo que a temperatura da fase gasosa seja inferior à da fase líquida, de forma que as digestões são realizadas à pressão pouco elevada e, consequentemente, os tubos de digestão utilizados podem ter paredes menos espessas, permitindo o rápido aquecimento e resfriamento das amostras, bem como baixo custo de operação e manutenção, simplicidade, alta frequência analítica,; redução do consumo de reagentes e diminuição da geração de resíduos, dito equipamento provido de um gabinete (10) que evita a contaminação da atmosfera do laboratório por vapores ácidos e a perda dos componentes voláteis da amostra durante o aquecimento
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
The study of Antarctic archaeal communities adds information on the biogeography of this group and helps understanding the dynamics of biogenic methane production in such extreme habitats. Molecular methods were combined to methane flux determinations in Martel Inlet, Admiralty Bay, to assess archaeal diversity, to obtain information about contribution of the area to atmospheric methane budget and to detect possible interferences of the Antarctic Brazilian Station Comandante Ferraz (EACF) wastewater discharge on local archaeal communities and methane emissions. Methane fluxes in Martel Inlet ranged from 3.2 to 117.9 mu mol CH(4) m(-2) d(-1), with an average of 51.3 +/- 8.5 mu mol CH(4) m(-2) d(-1) and a median of 57.6 mu mol CH(4) m(-2)d(-1). However, three negative fluxes averaging -11.3 mu mol CH(4) m(-2) d(-1) were detected in MacKellar Inlet, indicating that Admiralty Bay can be either a source or sink of atmospheric methane. Denaturing gradient gel electrophoresis (DGGE) showed that archaeal communities at EACF varied with depth and formed a group separated from the reference sites. Granulometric analysis indicated that differences observed may be mostly related to sediment type. However, an influence of wastewater input could not be discarded, since higher methane fluxes were found at CF site. suggesting stimulation of local methanogenesis. DGGE profile of the wastewater sample grouped separated from all other samples, suggesting that methanogenesis stimulation may be due to changes in environmental conditions rather than to the input of allochtonous species from the wastewater. 16S ribosomal DNA clone libraries analysis showed that all wastewater sequences were related to known methanogenic groups belonging to the hydrogenotrophic genera Methanobacterium and Methanobrevibacter and the aceticlastic genus Methanosaeta. EACF and Botany Point sediment clone libraries retrieved only groups of uncultivated Archaea, with predominance of Crenarchaeota representatives (MCG, MG1, MBG-B, MBG-C and MHVG groups). Euryarchaeota sequences found were mostly related to the LDS and RC-V groups, but MBG-D and DHVE-5 were also present. No representatives of cultivated methanogenic groups were found, but coverage estimates suggest that a higher number of clones would have to be analyzed in order to cover the greater archaeal diversity of Martel Inlet sediment. Nevertheless, the analysis of the libraries revealed groups not commonly found by other authors in Antarctic habitats and also indicated the presence of groups of uncultivated archaea previously associated to methane rich environments or to the methane cycle. (C) 2010 Elsevier Ltd. All rights reserved.
Resumo:
We compared the microbial community composition in soils from the Brazilian Amazon with two contrasting histories; anthrosols and their adjacent non-anthrosol soils of the same mineralogy. The anthrosols, also known as the Amazonian Dark Earths or terra preta, were managed by the indigenous pre-Colombian Indians between 500 and 8,700 years before present and are characterized by unusually high cation exchange capacity, phosphorus (P), and calcium (Ca) contents, and soil carbon pools that contain a high proportion of incompletely combusted biomass as biochar or black carbon (BC). We sampled paired anthrosol and unmodified soils from four locations in the Manaus, Brazil, region that differed in their current land use and soil type. Community DNA was extracted from sampled soils and characterized by use of denaturing gradient gel electrophoresis (DGGE) and terminal restriction fragment length polymorphism. DNA bands of interest from Bacteria and Archaea DGGE gels were cloned and sequenced. In cluster analyses of the DNA fingerprints, microbial communities from the anthrosols grouped together regardless of current land use or soil type and were distinct from those in their respective, paired adjacent soils. For the Archaea, the anthrosol communities diverged from the adjacent soils by over 90%. A greater overall richness was observed for Bacteria sequences as compared with those of the Archaea. Most of the sequences obtained were novel and matched those in databases at less than 98% similarity. Several sequences obtained only from the anthrosols grouped at 93% similarity with the Verrucomicrobia, a genus commonly found in rice paddies in the tropics. Sequences closely related to Proteobacteria and Cyanobacteria sp. were recovered only from adjacent soil samples. Sequences related to Pseudomonas, Acidobacteria, and Flexibacter sp. were recovered from both anthrosols and adjacent soils. The strong similarities among the microbial communities present in the anthrosols for both the Bacteria and Archaea suggests that the microbial community composition in these soils is controlled more strongly by their historical soil management than by soil type or current land use. The anthrosols had consistently higher concentrations of incompletely combusted organic black carbon material (BC), higher soil pH, and higher concentrations of P and Ca compared to their respective adjacent soils. Such characteristics may help to explain the longevity and distinctiveness of the anthrosols in the Amazonian landscape and guide us in recreating soils with sustained high fertility in otherwise nutrient-poor soils in modern times.
Resumo:
Combining data from multiple analytical platforms is essential for comprehensive study of the molecular phenotype (metabotype) of a given biological sample. The metabolite profiles generated are intrinsically dependent on the analytical platforms, each requiring optimization of instrumental parameters, separation conditions, and sample extraction to deliver maximal biological information. An in-depth evaluation of extraction protocols for characterizing the metabolome of the hepatobiliary fluke Fasciola hepatica, using ultra performance liquid chromatography and capillary electrophoresis coupled with mass spectroscopy is presented. The spectrometric methods were characterized by performance, and metrics of merit were established, including precision, mass accuracy, selectivity, sensitivity, and platform stability. Although a core group of molecules was common to all methods, each platform contributed a unique set, whereby 142 metabolites out of 14,724 features were identified. A mixture design revealed that the chloroform:methanol:water proportion of 15:59:26 was globally the best composition for metabolite extraction across UPLC-MS and CE-MS platforms accommodating different columns and ionization modes. Despite the general assumption of the necessity of platform-adapted protocols for achieving effective metabotype characterization, we show that an appropriately designed single extraction procedure is able to fit the requirements of all technologies. This may constitute a paradigm shift in developing efficient protocols for high-throughput metabolite profiling with more-general analytical applicability.