Mouse retinal development: Role of cell adhesion and mechanism of gene regulation

Cell differentiation and pattern formation are fundamental processes in animal development that are under intense investigation. The mouse retina is a good model to study these processes because it has seven distinct cell types, and three well-laminated nuclear layers that form during embryonic and postnatal life. β-catenin functions as both the nuclear effector for the canonical Wnt pathway and a cell adhesion molecule, and is required for the development of various organs. To study the function of β-catenin in retinal development, I used a Cre-loxP system to conditionally ablate β-catenin in the developing retina. Deletion of β-catenin led to disrupted laminar structure but did not affect the differentiation of any of the seven cell types. Eliminating β-catenin did not reduce progenitor cell proliferation, although enhanced apoptosis was observed. Further analysis showed that disruption of cell adhesion was the major cause of the observed patterning defects. Overexpression of β-catenin during retinal development also disrupted the normal retinal lamination and caused a transdifferentiation of neurons into pigmented cells. The results indicate that β-catenin functions as a cell adhesion molecule but not as a Wnt pathway component during retinal neurogenesis, and is essential for lamination but not cell differentiation. The results further imply that retinal lamination and cell differentiation are genetically separable processes. ^ Sonic hedgehog (shh) is expressed in retinal ganglion cells under the control of transcription factor Pou4f2 during retinal development. Previous studies identified a phylogenetically conserved region in the first intron of shh containing a Pou4f2 binding site. Transgenic reporter mice in which reporter gene expression was driven by this region showed that this element can direct gene expression specifically in the retina, but expression was not limited to the ganglion cells. From these data I hypothesized that this element is required for shh expression in the retina but is not sufficient for specific ganglion cell expression. To further test this hypothesis, I created a conditional allele by flanking this region with two loxP sites. Lines carrying this allele will be crossed with retinal-specific Cre lines to remove this element in the retina. My hypothesis predicts that alteration in shh expression and subsequent retinal defects will occur in the retinas of these mice. ^

IDENTIFICATION AND CHARACTERIZATION OF DISTINCT POPULATIONS OF CLONOGENIC BONE MARROW STROMAL CELLS CAPABLE OF TRANSFERRING THE HEMATOPOIETIC MICROENVIRONMENT IN VIVO AND SUPPORTING LT-HSCs IN VITRO

Bone marrow (BM) stromal cells are ascribed two key functions, 1) stem cells for non-hematopoietic tissues (MSC) and 2) as components of the hematopoietic stem cell niche. Current approaches studying the stromal cell system in the mouse are complicated by the low yield of clonogenic progenitors (CFU-F). Given the perivascular location of MSC in BM, we developed an alternative methodology to isolate MSC from mBM. An intact ‘plug’ of bone marrow is expelled from bones and enzymatically disaggregated to yield a single cell suspension. The recovery of CFU-F (1917.95+199) reproducibly exceeds that obtained using the standard BM flushing technique (14.32+1.9) by at least 2 orders of magnitude (P<0.001; N = 8) with an accompanying 196-fold enrichment of CFU-F frequency. Purified BM stromal and vascular endothelial cell populations are readily obtained by FACS. A detailed immunophenotypic analysis of lineage depleted BM identified PDGFRαβPOS stromal cell subpopulations distinguished by their expression of CD105. Both subpopulations retained their original phenotype of CD105 expression in culture and demonstrate MSC properties of multi-lineage differentiation and the ability to transfer the hematopoietic microenvironment in vivo. To determine the capacity of either subpopulation to support long-term multi-lineage reconstituting HSCs, we fractionated BM stromal cells into either the LinNEGPDGFRαβPOSCD105POS and LINNEGPDGFRαβPOSCD105LOW/- populations and tested their capacity to support LT-HSC by co-culturing each population with either 1 or 10 HSCs for 10 days. Following the 10 day co-culture period, both populations supported transplantable HSCs from 10 cells/well co-cultures demonstrating high levels of donor repopulation with an average of 65+23.6% chimerism from CD105POS co-cultures and 49.3+19.5% chimerism from the CD105NEG co-cultures. However, we observed a significant difference when mice were transplanted with the progeny of a single co-cultured HSC. In these experiments, CD105POS co-cultures (100%) demonstrated long-term multi- lineage reconstitution, while only 4 of 8 mice (50%) from CD105NEG -single HSC co-cultures demonstrated long-term reconstitution, suggesting a more limited expansion of functional stem cells. Taken together, these results demonstrate that the PDGFRαβCD105POS stromal cell subpopulation is distinguished by a unique capacity to support the expansion of long-term reconstituting HSCs in vitro.

CHARACTERIZATION AND TREATMENT OF A NOVEL MOUSE MODEL OF TSC-ASSOCIATED AUTISM

Tuberous sclerosis complex (TSC) is a dominant tumor suppressor disorder caused by mutations in either TSC1 or TSC2. The proteins of these genes form a complex to inhibit the mammalian target of rapamycin complex 1 (mTORC1), which controls protein translation and cell growth. TSC causes substantial neuropathology, often leading to autism spectrum disorders (ASDs) in up to 60% of patients. The anatomic and neurophysiologic links between these two disorders are not well understood. However, both disorders share cerebellar abnormalities. Therefore, we have characterized a novel mouse model in which the Tsc2 gene was selectively deleted from cerebellar Purkinje cells (Tsc2f/-;Cre). These mice exhibit progressive Purkinje cell degeneration. Since loss of Purkinje cells is a well-reported postmortem finding in patients with ASD, we conducted a series of behavior tests to assess if Tsc2f/-;Cre mice displayed autistic-like deficits. Using the three chambered social choice assay, we found that Tsc2f/-;Cre mice showed behavioral deficits, exhibiting no preference between a stranger mouse and an inanimate object, or between a novel and a familiar mouse. Tsc2f/-;Cre mice also demonstrated increased repetitive behavior as assessed with marble burying activity. Altogether, these results demonstrate that loss of Tsc2 in Purkinje cells in a haploinsufficient background lead to behavioral deficits that are characteristic of human autism. Therefore, Purkinje cells loss and/or dysfunction may be an important link between TSC and ASD. Additionally, we have examined some of the cellular mechanisms resulting from mutations in Tsc2 leading to Purkinje cell death. Loss of Tsc2 led to upregulation of mTORC1 and increased cell size. As a consequence of increased protein synthesis, several cellular stress pathways were upregulated. Principally, these included altered calcium signaling, oxidative stress, and ER stress. Likely as a consequence of ER stress, there was also upregulation of ubiquitin and autophagy. Excitingly, treatment with an mTORC1 inhibitor, rapamycin attenuated mTORC1 activity and prevented Purkinje cell death by reducing of calcium signaling, the ER stress response, and ubiquitin. Remarkably, rapamycin treatment also reversed the social behavior deficits, thus providing a promising potential therapy for TSC-associated ASD.

ROLE OF STAT3 IN KERATINOCYTE STEM CELLS DURING SKIN TUMORIGENESIS

STATs play crucial roles in a wide variety of biological functions, including development, proliferation, differentiation, migration and in cancer development. In the present study, we examined the impact of Stat3 deletion or activation on behavior of keratinocytes, including keratinocyte stem cells (KSCs). Deletion of Stat3 specifically in the bulge region of the hair follicle using K15.CrePR1 X Stat3fl/fl mice led to decreased tumor development by altering survival of bulge region KSCs. To further understand the role of KSCs in skin tumorigenesis, K5.Stat3C transgenic (Tg) mice which express a constitutively active/dimerized form of Stat3 called Stat3C via the bovine keratin 5 (K5) promoter were studied. The number of CD34 and α6 integrin positive cells was significantly reduced in Tg mice as compared to non-transgenic (NTg) littermates. There was a concomitant increase in the progenitor populations (Lgr-6, Lrig-1 and Sca-1) in the Tg mice vs. the stem cell population (CD34 and Keratin15). To investigate the mechanism underlying the increase in the progenitor population at the expense of bulge region KSCs we examined if Stat3C expression was involved in inducing migration of the bulge region KSCs. There was altered β-catenin and α6-integrin expression in the hair follicles of Tg mice, which may have contributed to reduced adhesive interactions between the epithelial cells and the basement membrane facilitating migration out of the niche. To further study the effect of Stat3 on differentiation of keratinocytes we analyzed the epidermal keratinocytes in K5.Cre X Stat3fl/fl mice. There was an increase in the expression of epidermal differentiation markers in the Stat3 knockout mice. These data suggest that deletion of Stat3 in the epidermis and hair follicle induced differentiation in these cells. Preliminary studies done with the BK5.Stat3C mouse model suggests that multiple hair follicle stem/progenitor populations may be involved in skin tumor development and progression in this model of skin tumorigenesis. Overall, these data suggest that Stat3 plays an important role in differentiation as well as migration of keratinocytes and that these effects may play a role during epithelial carcinogenesis.

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE Publication No.___________ Lisa Harn-Ging Shiue, B.S. Supervisory Professor: Madeleine Duvic, M.D. Extracorporeal photopheresis (ECP) is an effective, low-risk immunomodulating therapy for leukemic cutaneous T cell lymphoma (L-CTCL) and graft versus host disease (GVHD), but whether the mechanism(s) of action in these two diseases is (are) identical or different is unclear. To determine the effects of ECP in vivo, we studied regulatory T cells (T-regs), cytotoxic T lymphocytes (CTLs), and dendritic cells (DCs) by immunofluorescence flow cytometry in 18 L-CTCL and 11 GVHD patients before and after ECP at Day 2, 1 month, 3 months, and 6 months. In this study, ECP was effective in 12/18 L-CTCL patients with a 66.7% overall response rate (ORR) and 6/11 GVHD patients with a 54.5% ORR. Prior to ECP, the percentages of CD4+Foxp3+ T cells in 9 L-CTCL patients were either lower (L-CTCL-Low, n=2) or higher (L-CTCL-High, n=7) than normal. Five of the 7 GVHD patients had high percentages of CD4+Foxp3+ T cells (GVHD-High). Six of 7 L-CTCL-High patients had >80% CD4+Foxp3+ T cells which were correlated with tumor cells, and were responders. Both L-CTCL-High and GVHD-High patients had decreased percentages of CD4+Foxp3+ and CD4+Foxp3+CD25- T cells after 3 months of treatment. CD4+Foxp3+CD25+ T cells increased in GVHD-High patients but decreased in L-CTCL-High patients after 3 months of ECP. In addition, numbers of CTLs were abnormal. We confirmed that numbers of CTLs were low in L-CTCL patients, but high in GVHD patients prior to ECP. After ECP, CTLs increased after 1 month in 4/6 L-CTCL patients whereas CTLs decreased after 6 months in 3/3 GVHD patients. Myeloid (mDCs) and plasmacytoid DCs (pDCs) were also low at baseline in L-CTCL and GVHD patients confirming the DC defect. After 6 months of ECP, numbers and percentages of mDCs and pDCs increased in L-CTCL and GVHD. MDCs were favorably increased in 8/12 L-CTCL responders whereas pDCs were favorably increased in GVHD patients. These data suggest that ECP is favorably modulating the DC subsets. In L-CTCL patients, the mDCs may orchestrate Th1 cell responses to overcome immune suppression and facilitate disease regression. However, in GVHD patients, ECP is favorably down-regulating the immune system and may be facilitating immune tolerance to auto-or allo-antigens. In both L-CTCL and GVHD patients, DCs are modulated, but the T cell responses orchestrated by the DCs are different, suggesting that ECP modulates depending on the immune milieu. _______________

GENOME-WIDE PROFILING UNVEILS CRITICIAL FUNCTIONS OF p53 IN HUMAN EMBRYONIC STEM CELLS

Embryonic stem cells (ESCs) possess two unique characteristics: infinite self-renewal and the potential to differentiate into almost every cell type (pluripotency). Recently, global expression analyses of metastatic breast and lung cancers revealed an ESC-like expression program or signature, specifically for cancers that are mutant for p53 function. Surprisingly, although p53 is widely recognized as the guardian of the genome, due to its roles in cell cycle checkpoints, programmed cell death or senescence, relatively little is known about p53 functions in normal cells, especially in ESCs. My hypothesis is that p53 has specific transcription regulatory functions in human ESCs (hESCs) that a) oppose pluripotency and b) protect the stem cell genome in response to DNA damage and stress signaling. In mouse ESCs, these roles are believed to coincide, as p53 promotes differentiation in response to DNA damage, but this is unexplored in hESCs. To determine the biological roles of p53, specifically in hESCs, we mapped genome-wide chromatin interactions of p53 by chromatin immunoprecipitation and massively parallel tag sequencing (ChIP-Seq), and did so under three VIdifferent conditions of hESC status: pluripotency, differentiation-initiated and DNA-damage-induced. ChIP-Seq showed that p53 is enriched at distinct, induction-specific gene loci during each of these different conditions. Microarray gene expression analysis and functional annotation of the distinct p53-target genes revealed that p53 regulates specific genes encoding developmental regulators, which are expressed in differentiation-initiated but not DNA- damaged hESCs. We further discovered that, in response to differentiation signaling, p53 binds regions of chromatin that are repressed but also poised for rapid activation by core pluripotency factors OCT4 and NANOG in pluripotent hESCs. In response to DNA damage, genes associated with migration and motility are targeted by p53; whereas, the prime targets of p53 in control of cell death are conserved for p53 regulation in both differentiation and DNA damage. Our genome-wide profiling and bioinformatics analyses show that p53 occupies a special set of developmental regulatory genes during early differentiation of hESCs and functions in an induction-specific manner. In conclusion, our research unveiled previously unknown functions of p53 in ESC biology, which augments our understanding of one of the most deregulated proteins in human cancers.

STIMULATION THROUGH TLR4 INCREASES FVIII INHIBITOR FORMATION IN A MOUSE MODEL OF HEMOPHILIA A

Hemophilia A is a clotting disorder caused by functional factor VIII (FVIII) deficiency. About 25% of patients treated with therapeutic recombinant FVIII develop antibodies (inhibitors) that render subsequent FVIII treatments ineffective. The immune mechanisms of inhibitor formation are not entirely understood, but circumstantial evidence indicates a role for increased inflammatory response, possibly via stimulation of Toll-like receptors (TLRs), at the time of FVIII immunization. I hypothesized that stimulation through TLR4 in conjunction with FVIII treatments would increase the formation of FVIII inhibitors. To test this hypothesis, FVIII K.O. mice were injected with recombinant human FVIII with or without concomitant doses of TLR4 agonist (lipopoysaccharide; LPS). The addition of LPS combined with FVIII significantly increased the rate and the production of anti-FVIII IgG antibodies and neutralizing FVIII inhibitors. In the spleen, repeated in vivo TLR4 stimulation with LPS increased the relative percentage of macrophages and dendritic cells (DCs) over the course of 4 injections. However, repeated in vivo FVIII stimulation significantly increased the density of TLR4 expressed on the surface of all spleen antigen presenting cells (APCs). Culture of splenocytes isolated from mice revealed that the combined stimulation of LPS and FVIII also synergistically increased early secretion of the inflammatory cytokines IL-6, TNF-α, and IL-10, which was not maintained throughout the course of the repeated injections. While cytokine secretion was relatively unchanged in response to FVIII re-stimulation in culture, LPS re-stimulation in culture induced increased and prolonged inflammatory cytokine secretion. Re-stimulation with both LPS and FVIII induced cytokine secretion similar to LPS stimulation alone. Interestingly, long term treatment of mice with LPS alone resulted in splenocytes that showed reduced response to FVIII in culture. Together these results indicated that creating a pro-inflammatory environment through the combined stimulation of chronic, low-dose LPS and FVIII changed not only the populations but also the repertoire of APCs in the spleen, triggering the increased production of FVIII inhibitors. These results suggested an anti-inflammatory regimen should be instituted for all hemophilia A patients to reduce or delay the formation of FVIII inhibitors during replacement therapy.

Investigation of the mechanism of increased melanoma incidence in UV -irradiated mouse skin

The availability of transplantable, syngeneic murine melanomas made it possible to study the potential effects of UV radiation on the growth and progression of melanomas in an animal model. The purpose of my study was to determine how UV-irradiation increases the incidence of melanoma out-growth, when syngeneic melanoma cells are transplanted into a UV-irradiated site. Short term intermittent UVB exposure produces a transitory change in the mice which allows the increased outgrowth of melanoma cells injected into the UV-irradiated site. One possible mechanism is an immunomodulatory effect of UVR on the host. An alternative mechanism to account for the increased tumor incidence in the UV-irradiated site, is the release of inflammatory mediators from UV-irradiated epidermal cells. A third possibility is that UVR could induce the production and/or release of melanoma-specific growth factors resulting in increased melanoma outgrowth.^ My first step in distinguishing among these different possible mechanisms was to characterize further the conditions leading to increased development of melanoma cells in UV-irradiated mouse skin. Next, I attempted to determine which of the 3 proposed mechanisms was most likely. To do this, I defined the specificity of the effect by examining the growth of additional C3H tumorigenic cell lines in UV-irradiated skin. Second, I determined the immunogenicity of these tumor cell lines. The tumor cell lines exhibiting increased tumor incidence are restricted to those tumor cell lines which are immunogenic in normal C3H mice. Third, I determined the effect of UVR on melanoma development did not occur in immunosuppressed mice.^ Because of results from these three lines of investigation suggested that the effect was immunologically mediated, I then investigated whether specific immune reactions were affected by local UV irradiation. To accomplish this, I investigated the effect of UVR on cutaneous immune cells and on induction of contact hypersensitivity (CHS), and I also determined the effect of UVR on the development and the expression of systemic immunity against the melanoma cells. There is no clear cut relationship between the number of Langerhans or Thy1+ cells and the UV effect on tumor incidence. Furthermore, there was no suppression of CHS in the UV-irradiated mice. While the development of systemic immunity is significantly reduced, it appears to be sufficient to provide in vivo immunity to tumor challenge. However the elicitation of tumor immunity in immunized mice can be abrogated if tumor challenge occurs in the site of UV irradiation. This investigation provides new information on an effect of UVR on the elicitation of tumor immunity. Furthermore, it indicates that UV radiation can play a role in the development of melanoma other than just in the transformation of melanocytes. ^

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Functional studies of {\it twist\/} during mouse embryogenesis

A fundamental task in developmental biology is to understand the molecular mechanisms governing early embryogenesis. The aim of this study was to understand the developmental role of a putative basic helix-loop-helix (b-HLH) transcription factor, twist, during mouse embryogenesis.^ twist was originally identified in Drosophila as one of the zygotic genes, including snail, that were required for dorsal-ventral patterning. In Drosophila embryogenesis, twist is expressed in the cells of the ventral midline destined to form mesoderm. In embryos lacking twist expression, their ventral cells fail to form a ventral furrow and subsequently no mesoderm is formed.^ During mouse embryogenesis, twist is expressed after initial mesoderm formation in both mesoderm and cranial neural crest cell derivatives. To study the role of twist in vivo, twist-null embryos were generated by gene targeting. Embryos homozygous for the twist mutation die at midgestation. The most prominent phenotype in the present study was a failure of the cranial neural tube to close (exencephaly). twist-null embryos also showed defects in head mesenchyme, branchial arches, somites, and limb buds.^ To understand whether twist functions cell-autonomously and to investigate how twist-null cells interact with wild-type cells in vivo, twist chimeras composed of both twist-null and wild-type cells marked by the expression of the lacZgene were generated. Chimeric analysis revealed a correlation between the incidence of exencephaly and the contribution of the underlying twist-null head mesenchyme, thus strongly suggesting that twist-expressing head mesenchyme is required for the closure of the cranial neural tube. These studies have identified twist as a critical regulator for the mesenchymal fate determination within the cranial neural crest lineage. Most strikingly, twist-null head mesenchyme cells were always segregated from wild-type cells, indicating that the twist mutation altered the adhesive specificity of these cells. Furthermore, these results also indicated that twist functions cell-autonomously in the head, arch, and limb mesenchyme but non-cell-autonomously in the somites. Taken together, these studies have established the essential role of twist during mouse embryogenesis. ^

Neocortical hyperexcitability defect in a mutant mouse model of spike-wave epilepsy, {\it stargazer}

Single-locus mutations in mice can express epileptic phenotypes and provide critical insights into the naturally occurring defects that alter excitability and mediate synchronization in the central nervous system (CNS). One such recessive mutation (on chromosome (Chr) 15), stargazer(stg/stg) expresses frequent bilateral 6-7 cycles per second (c/sec) spike-wave seizures associated with behavioral arrest, and provides a valuable opportunity to examine the inherited lesion associated with spike-wave synchronization.^ The existence of distinct and heterogeneous defects mediating spike-wave discharge (SWD) generation has been demonstrated by the presence of multiple genetic loci expressing generalized spike-wave activity and the differential effects of pharmacological agents on SWDs in different spike-wave epilepsy models. Attempts at understanding the different basic mechanisms underlying spike-wave synchronization have focused on $\gamma$-aminobutyric acid (GABA) receptor-, low threshold T-type Ca$\sp{2+}$ channel-, and N-methyl-D-aspartate receptor (NMDA-R)-mediated transmission. It is believed that defects in these modes of transmission can mediate the conversion of normal oscillations in a trisynaptic circuit, which includes the neocortex, reticular nucleus and thalamus, into spike-wave activity. However, the underlying lesions involved in spike-wave synchronization have not been clearly identified.^ The purpose of this research project was to locate and characterize a distinct neuronal hyperexcitability defect favoring spike-wave synchronization in the stargazer brain. One experimental approach for anatomically locating areas of synchronization and hyperexcitability involved an attempt to map patterns of hypersynchronous activity with antibodies to activity-induced proteins.^ A second approach to characterizing the neuronal defect involved examining the neuronal responses in the mutant following application of pharmacological agents with well known sites of action.^ In order to test the hypothesis that an NMDA receptor mediated hyperexcitability defect exists in stargazer neocortex, extracellular field recordings were used to examine the effects of CPP and MK-801 on coronal neocortical brain slices of stargazer and wild type perfused with 0 Mg$\sp{2+}$ artificial cerebral spinal fluid (aCSF).^ To study how NMDA receptor antagonists might promote increased excitability in stargazer neocortex, two basic hypotheses were tested: (1) NMDA receptor antagonists directly activate deep layer principal pyramidal cells in the neocortex of stargazer, presumably by opening NMDA receptor channels altered by the stg mutation; and (2) NMDA receptor antagonists disinhibit the neocortical network by blocking recurrent excitatory synaptic inputs onto inhibitory interneurons in the deep layers of stargazer neocortex.^ In order to test whether CPP might disinhibit the 0 Mg$\sp{2+}$ bursting network in the mutant by acting on inhibitory interneurons, the inhibitory inputs were pharmacologically removed by application of GABA receptor antagonists to the cortical network, and the effects of CPP under 0 Mg$\sp{2+}$aCSF perfusion in layer V of stg/stg were then compared with those found in +/+ neocortex using in vitro extracellular field recordings. (Abstract shortened by UMI.) ^

Biological effects of PEA3 expression in {\it HER-2\/}/{\it neu\/}-overexpressing human cancer cells and the molecular mechanisms of PEA3-mediated transcriptional repression on {\it HER-2\/}/{\it neu\/}

HER-2/neu is a receptor tyrosine kinase highly homologous with epidermal growth factor receptor. Overexpression and/or amplification of HER-2/neu has been implicated in the genesis of a number of human cancers, especially breast and ovarian cancers. Transcriptional upregulation has been shown to contribute significantly to the overexpression of this gene. Studies on the transcriptional regulation of HER-2/neu gene are important for understanding the mechanism of cell transformation and developing the therapeutic strategies to block HER-2/neu-mediated cancers. PEA3 is a DNA binding transcriptional factor and its consensus sequence exists on the HER-2/neu promoter. To examine the role of PEA3 in HER-2/neu expression and cell transformation, we transfected PEA3 into the human breast and ovarian cancer cells that overexpress HER-2/neu and showed that PEA3 dramatically represses HER-2/neu transcription. PEA3 suppresses the oncogenic neu-mediated transformation in mouse fibroblast NIH 3T3 cells. Expression of PEA3 selectively blocks the growth of human cancer cells that overexpress HER-2/neu and inhibits their colony formation. It does not occur in the cancer cells expressing basal level of HER-2/neu. Further studies in the orthotopic ovarian cancer model demonstrated that expression of PEA3 preferentially inhibits growth and tumor development of human cancer cells that overexpress HER-2/neu, the tumor-bearing mice survived significantly longer if treated by injection of the PEA3-liposome complex intraperitoneally. Immunoblotting and immunohistochemical analysis of the tumor tissues indicated that PEA3 mediates the tumor suppression activity through targeting HER-2/neu-p185. Thus, PEA3 is a negative regulator of HER-2/neu gene expression and functions as a tumor suppressor gene in the HER-2/neu-overexpressing human cancer cells.^ The molecular mechanisms of PEA3 mediated transcriptional repression were investigated. PEA3 binds specifically at the PEA3 site on HER-2/neu promoter and this promoter-binding is required for the PEA3 mediated transcriptional repression. Mutation of the PEA3 binding site on HER-2/neu promoter causes decreased transcriptional activity, indicating that the PEA3 binding site is an enhancer-like element in the HER-2/neu-overexpressing cells. We therefore hypothesized that in the HER-2/neu-overexpressing cells, PEA3 competes with a transactivator for binding to the PEA3 site, preventing the putative factor from activating the transcription of HER-2/neu. This hypothesis was supported by the data which demonstrate that PEA3 competes with another nuclear protein for binding to the HER-2/neu promoter in vitro, and expression of a truncated protein which encodes the DNA binding domain of PEA3 is sufficient to repress HER-2/neu transcription in the HER-2/neu-overexpressing human cancer cells. ^

Altered tumorigenic phenotype in mice with a hypomorphic p53 mutant allele

Mutations in the p53 tumor suppressor gene are found in over 50% of human tumors and in the germline of Li-Fraumeni syndrome families. About 80% of these mutations are missense in nature. In order to study how p53 missense mutations affect tumorigenesis in vivo, we focused on the murine p53 arg-to-his mutation at amino acid 172, which corresponds to the human hot spot mutation at amino acid 175. The double replacement procedure was employed to introduce the p53 R172H mutation into the p53 locus of ES cells and mice were generated. An additional 1bp deletion in the intron 2 splice acceptor site was detected in the same allele in mice. We named this allele p53R172HΔg. This allele makes a small amount of full length p53 mutant protein. ^ Spontaneous tumor formation and survival were studied in these mice. Mice heterozygous for the p53R172HΔg allele showed 50% survival at 17 months of age, similar to the p53+/− mice. Moreover, the p53R172HΔg/+ mice showed a distinct tumor spectrum: 55% sarcomas, including osteosarcoms, fibrosarcomas and angiosarcomas; 27% carcinomas, including lung adenocarcinomas, squamous cell carcinomas, hepatocellular carcinomas and islet cell carcinomas; and 18% lymphomas. Compared to the p53+/− mice, there was a clear increase in the frequency of carcinoma development and a decrease in lymphoma incidence. Among the sarcomas that developed, fibrosarcomas in the skin were also more frequently observed. More importantly, osteosarcomas and carinomas that developed in the p53R172HΔg/+ mice metastasized at very high frequency (64% and 67%, respectively) compared with less than 10% in the p53+/− mice. The metastatic lesions were usually found in lung and liver, and less frequently in other tissues. The altered tumor spectrum in the mice and increased metastatic potential of the tumors suggested that the p53R172H mutation represents a gain-of-function. ^ Mouse embryonic fibroblasts (MEFs) from the mice homozygous and heterozygous for the p53R172HΔg allele were studied for growth characteristics, immortalization potential and genomic instability. All of the p53R172HΔg /+ MEF lines are immortalized under a 3T3 protocol while under the same protocol p53+/− MEFs are not immortalized. Karyotype analysis showed a persistent appearance of chromosome end-to-end fusion in the MEFs both homozygous and heterozygous for the p53R172HΔg allele. These observations suggest that increased genomic instability in the cells may cause the altered tumor phenotypes. ^

IL -12 inhibits the metastatic potential of osteosarcoma cells and induces tumor regression via a mechanism involving Fas /Fas ligand pathway

Despite multiple changes in the adjuvant chemotherapy regimens used to treat osteosarcoma (OS), the 2-year metastasis-free survival has remained at 65–70% for the past 10 years. Characterizing the molecular determinants that permit metastatic spread of tumor cells is a crucial element in developing new approaches for the treatment of osteosarcoma. Since OS metastasizes almost exclusively to the lung, an organ with constitutive Fas ligand (FasL) expression, we hypothesized that the expression of Fas (CD95, APO-1) by OS cells may play a role in the ability of these cells to form lung metastases. Fas expression was quantified in human SAOS-2 OS cells and selected variants (LM2, LM4, LM5, LM6, LM7). Using northern blot, FACS and RT-PCR analysis, low Fas expression was found to correlate with higher metastatic potential in these cell lines. The highly metastatic LM7 cell line was transfected with the full-length human Fas gene and injected into athymic nude mice. The median number of metastatic nodules per mouse fell from over 200 to 1.1 and the size of the nodules decreased from a range of 0.5–9.0 mm to less than 0.5 mm in the Fas-transfected cell line compared to the native LM7 cell line. Additionally, the subsequent incidence of lung metastases was lower in the Fas-expressing cell line. IL-12 was seen to upregulate Fas expression in the highly metastatic LM sublines in vitro. To visualize the effects of IL-12 in vivo, nude mice were injected with LM7 cells and treated biweekly for 4 weeks with Ad.mIL-12, saline control or Ad.βgal. Lung sections were analyzed via immunchistochemistry for Fas expression. A higher expression of Fas was found in tumors from mice receiving IL-12. To study the mechanism by which IL-12 upregulates Fas, LM7 cells were transfected with a luciferase reporter gene construct containing the full-length human fas promoter. Treatment with IL-12 increased luciferase activity. We therefore conclude that IL-12 influences the metastatic potential of OS cells by upregulating the fas promoter, resulting in increased cell surface Fas expression and susceptibility to Fas-induced cell death. ^