Increase of skeletal muscle relaxation speed by direct injection of parvalbumin cDNA.

Parvalbumin (PV) is a high affinity Ca(2+)-binding protein found at high concentration in fast-contracting/relaxing skeletal muscle fibers of vertebrates. It has been proposed that PV acts in the process of muscle relaxation by facilitating Ca2+ transport from the myofibrils to the sarcoplasmic reticulum. However, on the basis of metal-binding kinetics of PV in vitro, this hypothesis has been challenged. To investigate the function of PV in skeletal muscle fibers, direct gene transfer was applied in normal and regenerating rat soleus muscles which do not synthesize detectable amounts of PV. Two weeks after in vivo transfection with PV cDNA, considerable levels of PV mRNA and protein were detected in normal muscle, and even higher amounts were detected in regenerating muscle. Twitch half-relaxation time was significantly shortened in a dose-dependent way in transfected muscles, while contraction time remained unaltered. The observed shortening of half-relaxation time is due to PV and its ability to bind Ca2+, because a mutant protein lacking Ca(2+)-binding capacity did not promote any change in physiology. These results directly demonstrate the physiological function of PV as a relaxing factor in mammalian skeletal muscle.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription.

A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo.

The application of DNA technology to regulate the transcription of disease-related genes in vivo has important therapeutic potentials. The transcription factor E2F plays a pivotal role in the coordinated transactivation of cell cycle-regulatory genes such as c-myc, cdc2, and the gene encoding proliferating-cell nuclear antigen (PCNA) that are involved in lesion formation after vascular injury. We hypothesized that double-stranded DNA with high affinity for E2F may be introduced in vivo as a decoy to bind E2F and block the activation of genes mediating cell cycle progression and intimal hyperplasia after vascular injury. Gel mobility-shift assays showed complete competition for E2F binding protein by the E2F decoy. Transfection with E2F decoy inhibited expression of c-myc, cdc2, and the PCNA gene as well as vascular smooth muscle cell proliferation both in vitro and in the in vivo model of rat carotid injury. Furthermore, 2 weeks after in vivo transfection, neointimal formation was significantly prevented by the E2F decoy, and this inhibition continued up to 8 weeks after a single transfection in a dose-dependent manner. Transfer of an E2F decoy can therefore modulate gene expression and inhibit smooth muscle proliferation and vascular lesion formation in vivo.

Immortalization of human primary B lymphocytes in vitro with DNA.

Epstein-Barr virus (EBV) is a human DNA tumor virus that efficiently immortalizes human primary B lymphocytes in vitro. Although viral genes that are expressed in latently infected B lymphocytes have been shown to function in cellular growth control, their detailed genetic analysis has been cumbersome for two reasons. The viral genome is too large to permit genetic engineering and human primary B lymphocytes, the only targets for infection by EBV in vitro, are both intractable in culture and recalcitrant to DNA transfection. To overcome these obstacles, we have assembled all the essential genes of EBV on a single recombinant vector molecule in Escherichia coli. We show here that this mini-EBV plasmid can yield immortalized B cells upon transfer of its naked DNA into human primary B lymphocytes. Established cell lines carry recombinant vector DNA and cannot support virus production. Because this DNA can be easily manipulated in E. coli, mutant mini-EBVs as well as foreign genes can now be introduced and studied successfully in recipient B lymphocytes from any human donors. These mini-EBVs therefore are potentially useful for human gene therapy.

The inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling.

Antigen-specific activation of T lymphocytes, via stimulation of the T-cell antigen receptor (TCR) complex, is marked by a rapid and sustained increase in the concentration of cytoplasmic free Ca2+ ([Ca2+]i). It has been suggested that the second messenger inositol 1,4,5-trisphosphate (IP3) produced after TCR stimulation binds to the IP3 receptor (IP3R), an intracellular Ca(2+)-release channel, and triggers the increase in [Ca2+]i that activates transcription of the gene for T-cell growth factor interleukin 2 (IL-2). However, the role of the IP3R in T-cell signaling and possibly in plasma membrane Ca2+ influx in T cells remains unproven. Stable transfection of T cells (Jurkat) with antisense type 1 IP3R cDNA prevented type 1 IP3R expression, providing a tool for dissecting the role of IP3 signaling during T-cell activation. T cells lacking type 1 IP3R failed to increase [Ca2+]i or produce IL-2 after TCR stimulation. Moreover, depletion of intracellular Ca2+ stores without TCR activation stimulated Ca2+ influx in cells lacking the type 1 IP3R. These results establish that the type 1 IP3R is required for intracellular Ca2+ release that triggers antigen-specific T-cell proliferation but not for plasma membrane Ca2+ influx.

Pax5 (BSAP) regulates the murine immunoglobulin 3' alpha enhancer by suppressing binding of NF-alpha P, a protein that controls heavy chain transcription.

The Pax5 transcription factor BSAP (B-cell-specific activator protein) is known to bind to and repress the activity of the immunoglobulin heavy chain 3' alpha enhancer. We have detected an element--designated alpha P--that lies approximately 50 bp downstream of the BSAP binding site 1 and is required for maximal enhancer activity. In vitro binding experiments suggest that the 40-kDa protein that binds to this element (NF-alpha P) is a member of the Ets family present in both B-cell and plasma-cell nuclei. However, in vivo footprint analysis suggests that the alpha P site is occupied only in plasma cells, whereas the BSAP site is occupied in B cells but not in plasma cells. When Pax5 binding to the enhancer in B cells was blocked in vivo by transfection with a triple-helix-forming oligonucleotide an alpha P footprint appeared and endogenous immunoglobulin heavy chain transcripts increased. The triple-helix-forming oligonucleotide also increased enhancer activity of a transfected construct in B cells, but only when the alpha P site was intact. Pax5 thus regulates the 3' alpha enhancer and immunoglobulin gene transcription by blocking activation by NF-alpha P.

Molecular cloning and characterization of a conserved nuclear serine(threonine) protein kinase.

Human, Drosophila melanogaster, and Caenorhabditis elegans cDNA clones encoding homologues of a serine(threonine) protein kinase (EC 2.7.1.37) (designated Ndr protein kinase) have been isolated and sequenced. The human and Drosophila cDNAs predict polypeptides of 54 kDa and 52 kDa, respectively, which share approximately 80% amino acid similarity. Northern analysis of human tissues revealed a ubiquitously expressed 3.9-kb transcript. Recombinant GST-Ndr underwent intramolecular autophosphorylation on serine and threonine residues in vitro but failed to transphosphorylate several standard protein kinase substrates. Transfection of the human cDNA into COS-1 cells resulted in the appearance of an intense nuclear staining in cells analyzed by indirect immunofluorescence; deletion mutagenesis identified a short basic peptide, KRKAETWKRNRR, responsible for the nuclear accumulation of Ndr. Thus, Ndr is a conserved and widely expressed nuclear protein kinase. The closest known relative of this previously uncharacterized kinase is Dbf2, a budding yeast protein kinase required for the completion of nuclear division.

Study of the role of retinoblastoma protein in terminal differentiation of murine erythroleukemia cells.

Hexamethylenebisacetamide-induced terminal differentiation of Friend virus-transformed murine erythroleukemia (MEL) cells can be inhibited by okadaic acid, an inhibitor of type 1 and type 2A protein phosphatases. The inhibition is shown to be correlated with prevention of dephosphorylation of retinoblastoma protein (pRB) in cells and bypass of G1 prolongation in the cell cycle. These results suggest that pRB-mediated G1 prolongation is necessary for MEL cells to commit to terminal differentiation. However, further experiments demonstrate that the simple cell cycle exit is not sufficient for commitment to terminal differentiation. Induction of dephosphorylation of pRB and subsequent G1 prolongation by forskolin does not lead MEL cells to differentiate. Additional pRB has been expressed in MEL cells by transfection with a neo-resistant plasmid containing RB cDNA under the control of a cytomegalovirus promoter. Exogenously expressed pRB is hyperphosphorylated in logarithmically growing MEL cells without any noticeable change in growth rate between the transfected cell line and the parental cell line. This result suggests that pRB in MEL cells is regulated by protein kinases and protein phosphatases and not by transcription.

Mutations in the kinesin-like protein Eg5 disrupting localization to the mitotic spindle.

Eg5, a member of the bimC subfamily of kinesin-like microtubule motor proteins, localizes to spindle microtubules in mitosis but not to interphase microtubules. We investigated the molecular basis for spindle localization by transient transfection of Xenopus A6 cells with myc-tagged derivatives of Eg5. Expressed at constitutively high levels from a cytomegalovirus promoter, mycEg5 protein is cytoplasmic throughout interphase, begins to bind microtubules in early prophase, and remains localized to spindle and/or midbody microtubules through mitosis to the end of telophase. Both N- and C-terminal regions of Eg5 are required for this cell-cycle-regulated targeting. Eg5 also contains within its C-terminal domain a sequence conserved among bimC subfamily proteins that includes a potential p34cdc2 phosphorylation site. We show that mutation of a single threonine (T937) within this site to nonphosphorylatable alanine abolishes localization of the mutant protein to the spindle, whereas mutation of T937 to serine preserves spindle localization. We hypothesize that phosphorylation of Eg5 may regulate its localization to the spindle in the cell cycle.

A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity.

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

Regulation of T-cell antigen receptor (TCR) alpha-chain expression by TCR beta-chain transcripts.

The TCR is an alpha beta heterodimer, a part of the multimeric structure through which physiological T-cell activation occurs. The expression of TCR alpha chain is greatly diminished in a beta-chain-deficient mutant Jurkat cell line (J.RT3-T3.5). The relationship between the expression of the TCR alpha and beta chains has been examined by stable transfection of a series of TCR beta-chain mutant constructs into this mutant cell line. The level of alpha-chain transcript was dramatically upregulated by the expression of the beta chain and specifically by a transcript of the beta-chain variable region alone, including a transcript in which the ATG start codon was mutated. The downregulation of the endogenous alpha-chain transcripts in mutants cells lacking complete beta-chain transcripts occurred primarily at the posttranscriptional level. This evidence for a regulatory function of the TCR beta-chain gene represents an unusual regulatory pathway in which the transcript of one gene is required for the optimal expression of another gene.

The hepatitis B virus X protein targets the basic region-leucine zipper domain of CREB.

The X gene product encoded by the hepatitis B virus, termed pX, is a promiscuous transactivator of a variety of viral and cellular genes under the control of diverse cis-acting elements. Although pX does not appear to directly bind DNA, pX-responsive elements include the NF-kappa B, AP-1, and CRE (cAMP response element) sites. Direct protein-protein interactions occur between viral pX and the CRE-binding transcription factors CREB and ATF. Here we examine the mechanism of the protein-protein interactions occurring between CREB and pX by using recombinant proteins and in vitro DNA-binding assays. We demonstrate that pX interacts with the basic region-leucine zipper domain of CREB but not with the DNA-binding domain of the yeast transactivator protein Gal4. The interaction between CREB and pX increases the affinity of CREB for the CRE site by an order of magnitude, although pX does not alter the rate of CREB dimerization. Methylation interference footprinting reveals differences between the CREB DNA and CREB-pX DNA complexes. These experiments demonstrate that pX titers the way CREB interacts with the CRE DNA and suggest that the basic, DNA-binding region of CREB is the target of pX. Transfection assays in PC12 cells with the CREB-dependent somatostatin promoter demonstrate a nearly 15-fold transcriptional induction after forskolin stimulation in the presence of pX. These results support the significance of the CREB-pX protein-protein interactions in vivo.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

DNA recombination is sufficient for retroviral transduction.

Oncogenic retroviruses carry coding sequences that are transduced from cellular protooncogenes. Natural transduction involves two nonhomologous recombinations and is thus extremely rare. Since transduction has never been reproduced experimentally, its mechanism has been studied in terms of two hypotheses: (i) the DNA model, which postulates two DNA recombinations, and (ii) the RNA model, which postulates a 5' DNA recombination and a 3' RNA recombination occurring during reverse transcription of viral and protooncogene RNA. Here we use two viral DNA constructs to test the prediction of the DNA model that the 3' DNA recombination is achieved by conventional integration of a retroviral DNA 3' of the chromosomal protooncogene coding region. For the DNA model to be viable, such recombinant viruses must be infectious without the purportedly essential polypurine tract (ppt) that precedes the 3' long terminal repeat (LTR) of all retroviruses. Our constructs consist of a ras coding region from Harvey sarcoma virus which is naturally linked at the 5' end to a retroviral LTR and artificially linked at the 3' end either directly (construct NdN) or by a cellular sequence (construct SU) to the 5' LTR of a retrovirus. Both constructs lack the ppt, and the LTR of NdN even lacks 30 nucleotides at the 5' end. Both constructs proved to be infectious, producing viruses at titers of 10(5) focus-forming units per ml. Sequence analysis proved that both viruses were colinear with input DNAs and that NdN virus lacked a ppt and the 5' 30 nucleotides of the LTR. The results indicate that DNA recombination is sufficient for retroviral transduction and that neither the ppt nor the complete LTR is essential for retrovirus replication. DNA recombination explains the following observations by others that cannot be reconciled with the RNA model: (i) experimental transduction is independent of the packaging efficiency of viral RNA, and (ii) experimental transduction may invert sequences with respect to others, as expected for DNA recombination during transfection.