The geometry of optimal control solutions on some six dimensional lie groups

This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.

Approximate Riemann solutions of the two-dimensional shallow-water equations

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Similarity solutions of the shallow water equations

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Solutions of a two-dimensional dam-break problem

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Polymer − surfactant vesicular complexes in aqueous medium

The introduction of ionic single-tailed surfactants to aqueous solutions of EO18BO10 [EO = poly(ethylene oxide), BO = poly(1,2-butylene oxide), subscripts denote the number of repeating units] leads to the formation of vesicles, as probed by laser scanning confocal microscopy. Dynamic light scattering showed that the dimensions of these aggregates at early stages of development do not depend on the sign of the surfactant head group charge. Small-angle X-ray scattering (SAXS) analysis indicated the coexistence of smaller micelles of different sizes and varying polymer content in solution. In strong contrast to the dramatic increase of size of dispersed particles induced by surfactants in dilute solution, the d-spacing of corresponding mesophases reduces monotonically upon increasing surfactant loading. This effect points to the suppression of vesicles as a consequence of increasing ionic strength in concentrated solutions. Maximum enhancements of storage modulus and thermal stability of hybrid gels take place at different compositions, indicating a delicate balance between the number and size of polymer-poor aggregates (population increases with surfactant loading) and the number and size of polymer−surfactant complexes (number and size decrease in high surfactant concentrations).

Self-assembly and hydrogelation of an amyloid peptide fragment

The self-assembly of a fragment of the amyloid beta peptide that has been shown to be critical in amyloid fibrillization has been studied in aqueous solution. There are conflicting reports in the literature on the fibrillization of A beta (16-20), i.e., KLVFF, and our results shed light on this. In dilute solution, self-assembly of NH2-KLVFF-COOH is strongly influenced by aromatic interactions between phenylalanine units, as revealed by UV spectroscopy and circular dichroism. Fourier transform infrared (FTIR) spectroscopy reveals beta-sheet features in spectra taken for more concentrated solutions and also dried films. X-ray diffraction and cryo-transmission electron microscopy (cryo-TEM) provide further support for beta-sheet amyloid fibril formation. A comparison of cryo-TEM images with those from conventional dried and negatively stained TEM specimens highlights the pronounced effects of sample preparation on the morphology. A comparison of FTIR data for samples in solution and dried samples also highlights the strong effect of drying on the self-assembled structure. In more concentrated phosphate-buffered saline (PBS) solution, gelation of NH2-KLVFF-COOH is observed. This is believed to be caused by screening of the electrostatic charge on the peptide, which enables beta sheets to aggregate into a fibrillar gel network. The rheology of the hydrogel is probed, and the structure is investigated by light scattering and small-angle X-ray scattering.

Fibrillisation of hydrophobically modified amyloid peptide fragments in an organic solvent

The self-assembly of a hydrophobically modified fragment of the amyloid beta(A beta) peptide has been studied in methanol. The peptide FFKLVFF is based on A beta(16-20) extended at the N terminus by two phenylalanine residues. The formation of amyloid-type fibrils is confirmed by Congo Red staining, thioflavin T fluorescence and circular dichroism experiments. FTIR points to the formation of beta-sheet structures in solution and in dried films and suggests that aggregation occurs at low concentration and is not strongly affected by further increase in concentration, i.e. the peptide is a strong fibril-former in methanol. UV fluorescence experiments on unstained peptide and CD point to the importance of aromatic interactions between phenylalanine groups in driving aggregation into beta-sheets. The CD spectrum differs from that usually observed for beta-sheet assemblies formed by larger peptides or proteins and this is discussed for solutions in methanol and also trifluoroethanol. The fibril structure is imaged by transmission electron microscopy and scanning electron microscopy on dried samples and is confirmed by small-angle X-ray scattering experiments in solution.

Surface science studies of strong metal-oxide interactions on model catalysts

The strong metal support interaction (SMSI) was first described in 1978 by Tauster [1-4]. The effect was observed as a severely negative effect on CO and H2 uptake on the catalyst after high temperature calcination under reducing conditions (heating above ~ 700 K) [1,2]. It also had a negative effect on the reaction rate for reactions, such as alkane hydrogenolysis [5,6]. It appeared that the effect occurred for catalysts comprised of reducible supports which were treated at elevated temperature in reducing conditions [2-4]. A classic support which has manifested this behaviour in many studies is TiO2. Over the years following the first discovery of SMSI it has been recognised that the effect is not always negative – for instance for the CO-H2 reaction for which it appears to have a positive effect [5,6]. Further it was noted that hydrogen reduction was not necessary to observe the effect of CO adsorption suppression, it also occurs by vacuum treatment [7], though it should be noted that vacuum treatment at elevated temperature is, in effect, a reducing environment.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Strong-segregation limit of the self-consistent field theory for diblock copolymer melts

The self-consistent field theory (SCFT) introduced by Helfand for diblock copolymer melts is expected to converge to the strong-segregation theory (SST) of Semenov in the asymptotic limit, $\chi N \rightarrow \infty$. However, past extrapolations of the lamellar/cylinder and cylinder/sphere phase boundaries, within the standard unit-cell approximation, have cast some doubts on whether or not this is actually true. Here we push the comparison further by extending the SCFT calculations to $\chi N = 512,000$, by accounting for exclusion zones in the coronae of the cylindrical and spherical unit cells, and by examining finite-segregation corrections to SST. In doing so, we provide the first compelling evidence that SCFT does indeed reduce to SST.

Molecular dynamics simulations of threadlike cetyltrimethylammonium chloride micelles: effects of sodium chloride and sodium salicylate salts

We use atomistic molecular dynamics simulations to probe the effects of added sodium chloride (NaCl) and sodium salicylate (NaSal) salts on the spherical-to-threadlike micelle shape transition in aqueous solutions of cetyltrimethylammonium chloride (CTAC) surfactants. Long threadlike micelles are found to be unstable and break into spherical micelles at low concentrations or NaCl, but remain stable for 20 ns above a threshold value of [NaCl] approximate to 3.0 M, which is about 2.5 times larger than the experimental salt concentration at which the transition between spherical and rodlike micelles occurs. The chloride counterions associate weakly oil the surface of the CTAC micelles with the degree of counterion dissociation decreasing slightly with increasing [NaCl] on spherical micelles, but dropping significantly on the threadlike micelles tit high [NaCl]. This effect indicates that the electrolyte ions drive the micellar shape transition by screening the electrostatic repulsions between the micellar headgroups, The aromatic salicylate counterions, on the other hand, penetrate inside the micelle with their hydrophilic groups staying in the surfactant headgroup region and the hydrophobic groups partially embedded into the hydrophobic core of the micelle. The strong association of the salicylate ions with the surfactant headgroups leads to dense packing of the surfactant molecules, which effectively reduces the surface area per surfactant, and increases intramicellar ordering of the surfactant headgroups, favoring the formation of long threadlike micelles. Simulation predictions of the geometric and electrostatic properties of the spherical and threadlike micelles are in good agreement with experiments.

Stability of solutions of linear difference equations with periodic coefficients

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.