915 resultados para REGULATORY GUARANTEES


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous work has shown that N-terminal deletions of yeast histone H3 cause a 2- to 4-fold increase in the induction of GAL1 and a number of other genes involved in galactose metabolism. In contrast, deletions at the H4 N terminus cause a 10- to 20-fold decrease in the induction of these same GAL genes. However, H3 and H4 N-terminal deletions each decrease PHO5 induction only 2- to 4-fold. To define the GAL1 gene regulatory elements through which the histone N termini activate or repress transcription, fusions were made between GAL1 and PHO5 promoter elements attached to a beta-galactosidase reporter gene. We show here that GAL1 hyperactivation caused by the H3 N-terminal deletion delta 4-15 is linked to the upstream activation sequence. Conversely, the relative decrease in GAL1 induction caused by the H4N-terminal deletion delta 4-28 is linked to the downstream promoter which contains the TATA element. These data indicate that the H3 N terminus is required for the repression of the GAL1 upstream element, whereas the H4N terminus is required for the activation of the GAL1 downstream promoter element.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Steroidogenic acute regulatory protein (StAR) appears to mediate the rapid increase in pregnenolone synthesis stimulated by tropic hormones. cDNAs encoding StAR were isolated from a human adrenal cortex library. Human StAR, coexpressed in COS-1 cells with cytochrome P450scc and adrenodoxin, increased pregnenolone synthesis > 4-fold. A major StAR transcript of 1.6 kb and less abundant transcripts of 4.4 and 7.5 kb were detected in ovary and testis. Kidney had a lower amount of the 1.6-kb message. StAR mRNA was not detected in other tissues including placenta. Treatment of granulosa cells with 8-bromo-adenosine 3',5'-cyclic monophosphate for 24 hr increased StAR mRNA 3-fold or more. The structural gene encoding StAR was mapped using somatic cell hybrid mapping panels to chromosome 8p. Fluorescence in situ hybridization placed the StAR locus in the region 8p11.2. A StAR pseudogene was mapped to chromosome 13. We conclude that StAR expression is restricted to tissues that carry out mitochondrial sterol oxidations subject to acute regulation by cAMP and that StAR mRNA levels are regulated by cAMP.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The sulfur regulatory system of Neurospora crassa is composed of a set of structural genes involved in sulfur catabolism controlled by a genetically defined set of trans-acting regulatory genes. These sulfur regulatory genes include cys-3+, which encodes a basic region-leucine zipper transcriptional activator, and the negative regulatory gene scon-2+. We report here that the scon-2+ gene encodes a polypeptide of 650 amino acids belonging to the expanding beta-transducin family of eukaryotic regulatory proteins. Specifically, SCON2 protein contains six repeated G beta-homologous domains spanning the C-terminal half of the protein. SCON2 represents the initial filamentous fungal protein identified in the beta-transducin group. Additionally, SCON2 exhibits a specific amino-terminal domain that potentially defines another subfamily of beta-transducin homologs. Expression of the scon-2+ gene has been examined using RNA hybridization and gel mobility-shift analysis. The dependence of scon-2+ expression on CYS3 function and the binding of CYS3 to the scon-2+ promoter indicate the presence of an important control loop within the N. crassa sulfur regulatory circuit involving CYS3 activation of scon-2+ expression. On the basis of the presence of beta-transducin repeats, the crucial role of SCON2 in the signal-response pathway triggered by sulfur limitation may be mediated by protein-protein interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The NYSE transformed into a for profit entity in 2006. As part of the approval process, the NYSE agreed to structurally separate the regulatory function from the business function. In doing so, the NYSE created NYSE Regulation, a non-profit with an independent board, to handle most regulatory matters. During the comment period, a spirited debate arose over the ability of a for profit company to carry out a regulatory mission. Some suggested that the regulatory function was incompatible with a "for profit" motive and that NYSE Regulation should be spun off. Others accepted the proposed structure but called for additional changes designed to reduce the possible influence of the public holding company over the regulatory function. In the end, the SEC approved the structure but with a number of prophylactic safeguards including the requirement that NYSE Regulation have a board consisting of all independent directors (save the CEO) and that directors from the for profit holding company could not make up a majority of the board. More recently, however, the NYSE has proposed to end the structural separation of the two functions and instead put in place a functional separation. The proposal would result in the termination of the delegation agreement between the Exchange and NYSE Regulation and the creation of both a Regulatory Oversight Committee of the Board of Directors of the Exchange and the creation of a Chief Regulatory Officer. This letter examines the history of the separation of the two functions and critiques the NYSE's proposal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sodium phosphates are a class of chemicals that have been widely employed in commercial and consumer applications. However, declining use of these chemicals due to environmental concerns has lead to restructuring within the industry that has caused, and is likely to continue to cause, reduction of sodium phosphate production capacity. Closure of a sodium phosphate manufacturing plant necessitates decommissioning and decontamination activities that are subject to a variety of federal, state, and local regulations. A compliance plan was developed to provide a blueprint for ensuring that all federal regulatory requirements are met, however, site dependent state and local requirements were excluded. The compliance plan provides a framework that addresses project team formation and project planning, regulatory requirements, identification of affected processing equipment, plant pre-shutdown activities, waste stream identification and waste management facilities, safety, training, and emergency preparedness planning, and project decommissioning remedial actions. This regulatory compliance plan will enable sodium phosphate plant operators to complete decontamination and decommissioning work in a timely, efficient, compliant, and cost effective manner.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This project determined if the performance based septic system, proposed for a development on Black Hammock Island in Jacksonville, Florida, is the best choice to prevent environmental contamination from septic tanks and if adequate regulatory policy exists. Research shows a central wastewater treatment plant provides the most efficient pollutant removal but can be cost prohibitive. This project found performance based systems surpasses conventional septic system performance and are more suited and economical to remote areas without sewer service. This project finds current regulations to be inadequate and supports ordinance changes proposed by the Mayor of Jacksonville to enhance the current policy and provide more adequate and meaningful regulation.