Fluorescent quantitative PCR of Mycobacterium tuberculosis for differentiating intestinal tuberculosis from Crohn's disease

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Associations between CD36 gene polymorphisms and susceptibility to coronary artery heart disease

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Use of conventional PCR and smear microscopy to diagnose pulmonary tuberculosis in the Amazonian rainforest area

The diagnostic usefulness of Ziehl-Neelsen (ZN)-stained sputum smears combined with conventional polymerase chain reaction (ZN/PCR) to amplify IS6110 region DNA extracted from ZN slides was evaluated. The objective was to verify if this association could improve tuberculosis (TB) diagnosis in patients at remote sites. The study was carried out in 89 patients with culture-confirmed pulmonary TB as defined by the Brazilian Manual for TB Treatment. The participants were recruited in a reference unit for TB treatment in Rondônia, a state in the Amazonian area in northern Brazil. ZN, PCR, and culture performed in the sputum samples from these patients were analyzed in different combinations (i.e., ZN plus PCR and ZN plus culture). The prevalence rates of pulmonary TB in these patients were 32.6 and 28.1% considering culture and ZN/PCR, respectively. The sensitivity and specificity of ZN/PCR were 86 and 93%, respectively. ZN/PCR was able to detect more TB cases than ZN alone. This method could offer a new approach for accurate tuberculosis diagnosis, especially in remote regions of the world where culture is not available.

Role of chemokines in promoting instability of coronary atherosclerotic plaques and the underlying molecular mechanism

Our aim was to investigate the role of chemokines in promoting instability of coronary atherosclerotic plaques and the underlying molecular mechanism. Coronary angiography and intravascular ultrasound (IVUS) were performed in 60 stable angina pectoris (SAP) patients and 60 unstable angina pectoris (UAP) patients. The chemotactic activity of monocytes in the 2 groups of patients was examined in Transwell chambers. High-sensitivity C-reactive protein (hs-CRP), monocyte chemoattractant protein-1 (MCP-1), regulated on activation in normal T-cell expressed and secreted (RANTES), and fractalkine in serum were examined with ELISA kits, and expression of MCP-1, RANTES, and fractalkine mRNA was examined with real-time PCR. In the SAP group, 92 plaques were detected with IVUS. In the UAP group, 96 plaques were detected with IVUS. The plaques in the UAP group were mainly lipid 51.04% (49/96) and the plaques in the SAP group were mainly fibrous 52.17% (48/92). Compared with the SAP group, the plaque burden and vascular remodeling index in the UAP group were significantly greater than in the SAP group (P<0.01). Chemotactic activity and the number of mobile monocytes in the UAP group were significantly greater than in the SAP group (P<0.01). Concentrations of hs-CRP, MCP-1, RANTES, and fractalkine in the serum of the UAP group were significantly higher than in the serum of the SAP group (P<0.05 or P<0.01), and expression of MCP-1, RANTES, and fractalkine mRNA was significantly higher than in the SAP group (P<0.05). MCP-1, RANTES, and fractalkine probably promote instability of coronary atherosclerotic plaque.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Resveratrol inhibits the intracellular calcium increase and angiotensin/endothelin system activation induced by soluble uric acid in mesangial cells

Resveratrol (Resv) is natural polyphenol found in grapes. This study evaluated the protective effect of Resv against the effects of uric acid (UA) in immortalized human mesangial cells (ihMCs). ihMCs were preincubated with Resv (12.5 µM) for 1 h and treated with UA (10 mg/dL) for 6 or 12 h. The intracellular calcium concentration [Ca2+]i was quantified by fluorescence using flow cytometry. Angiotensinogen (AGT) and pre-pro endothelin-1 (ppET-1) mRNA were assayed by quantitative real-time RT-PCR. Angiotensin II (AII) and endothelin-1 (ET-1) were assayed by ELISA. UA significantly increased [Ca2+]i. Pre-incubation with Resv significantly reduced the change in [Ca2+]i induced by UA. Incubation with UA for 6 or 12 h also increased AGT mRNA expression and AII protein synthesis. Resv blunted these increases in AGT mRNA expression and AII protein. Incubation with UA in the ihMCs increased ppET-1 expression and ET-1 protein synthesis at 6 and 12 h. When ihMCs were pre-incubated with Resv, UA had a significantly diminished effect on ppET-1 mRNA expression and ET-1 protein synthesis at 6 and 12 h, respectively. Our results suggested that UA triggers reactions including AII and ET-1 production in mesangial cells. The renin-angiotensin system may contribute to the pathogenesis of renal function and chronic kidney disease. Resv can minimize the impact of UA on AII, ET-1 and the increase of [Ca2+]i in mesangial cells, suggesting that, at least in part, Resv can prevent the effects of soluble UA in mesangial cells.

Effects of propofol on lipopolysaccharide-induced expression and release of HMGB1 in macrophages

This study aimed to determine the effects of different concentrations of propofol (2,6-diisopropylphenol) on lipopolysaccharide (LPS)-induced expression and release of high-mobility group box 1 protein (HMGB1) in mouse macrophages. Mouse macrophage cell line RAW264.7 cells were randomly divided into 5 treatment groups. Expression levels of HMGB1 mRNA were detected using RT-PCR, and cell culture supernatant HMGB1 protein levels were detected using enzyme-linked immunosorbent assay (ELISA). Translocation of HMGB1 from the nucleus to the cytoplasm in macrophages was observed by Western blotting and activity of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in the nucleus was detected using ELISA. HMGB1 mRNA expression levels increased significantly in the cell culture supernatant and in cells after 24 h of stimulating RAW264.7 cells with LPS (500 ng/mL). However, HMGB1 mRNA expression levels in the P2 and P3 groups, which received 500 ng/mL LPS with 25 or 50 μmol/mL propofol, respectively, were significantly lower than those in the group receiving LPS stimulation (P<0.05). After stimulation by LPS, HMGB1 protein levels were reduced significantly in the nucleus but were increased in the cytoplasm (P<0.05). Simultaneously, the activity of NF-κB was enhanced significantly (P<0.05). After propofol intervention, HMGB1 translocation from the nucleus to the cytoplasm and NF-κB activity were inhibited significantly (each P<0.05). Thus, propofol can inhibit the LPS-induced expression and release of HMGB1 by inhibiting HMGB1 translocation and NF-κB activity in RAW264.7 cells, suggesting propofol may be protective in patients with sepsis.

A glycoprotein E gene-deleted bovine herpesvirus 1 as a candidate vaccine strain

A bovine herpesvirus 1 (BoHV-1) defective in glycoprotein E (gE) was constructed from a Brazilian genital BoHV-1 isolate, by replacing the full gE coding region with the green fluorescent protein (GFP) gene for selection. Upon co-transfection of MDBK cells with genomic viral DNA plus the GFP-bearing gE-deletion plasmid, three fluorescent recombinant clones were obtained out of approximately 5000 viral plaques. Deletion of the gE gene and the presence of the GFP marker in the genome of recombinant viruses were confirmed by PCR. Despite forming smaller plaques, the BoHV-1△gE recombinants replicated in MDBK cells with similar kinetics and to similar titers to that of the parental virus (SV56/90), demonstrating that the gE deletion had no deleterious effects on replication efficacy in vitro. Thirteen calves inoculated intramuscularly with BoHV-1△gE developed virus neutralizing antibodies at day 42 post-infection (titers from 2 to 16), demonstrating the ability of the recombinant to replicate and to induce a serological response in vivo. Furthermore, the serological response induced by recombinant BoHV-1△gE could be differentiated from that induced by wild-type BoHV-1 by the use of an anti-gE antibody ELISA kit. Taken together, these results indicated the potential application of recombinant BoHV-1 △gE in vaccine formulations to prevent the losses caused by BoHV-1 infections while allowing for differentiation of vaccinated from naturally infected animals.

Expression of BAFF and BR3 in patients with systemic lupus erythematosus

The objective of this study was to examine the relationship between the expression of B cell activating factor (BAFF) and BAFF receptor in patients with disease activity of systemic lupus erythematosus (SLE). Real-time RT-PCR was used to examine BAFF mRNA expression in peripheral blood monocytes of active and stable SLE patients and healthy controls. The percentage of BAFF receptor 3 (BR3) on B lymphocytes was measured by flow cytometry. Soluble BAFF levels in serum were assayed by ELISA. Microalbumin levels were assayed by an automatic immune analysis machine. BAFF mRNA and soluble BAFF levels were highest in the active SLE group, followed by the stable SLE group, and controls (P<0.01). The percentage of BR3 on B lymphocytes was downregulated in the active SLE group compared with the stable SLE group and controls (P<0.01). BAFF mRNA levels and soluble BAFF levels were higher in patients who were positive for proteinuria than in those who were negative (P<0.01). The percentage of BR3 on B lymphocytes was lower in patients who were positive for proteinuria than in those who were negative (P<0.01). The BAFF/BR3 axis may be over-activated in SLE patients. BAFF and BR3 levels may be useful parameters for evaluating treatment.

Eficiência de um kit de ELISA na detecção e quantificação de aflatoxina M1 em leite e investigação da ocorrência no estado de Minas Gerais

Procedimentos para validação intralaboratorial de kits de ELISA foram adotados na verificação da eficiência de um kit para detecção e quantificação de aflatoxina M1 em leite. Foram realizados ensaios com soluções padrões fornecidas pelo kit, amostras artificialmente contaminadas e amostras naturalmente contaminadas. Os valores médios de recuperação obtidos para os padrões do kit apresentaram-se entre 85,6 e 114,8%, com valores de coeficiente de variação entre 11,6 e 23,1%. Nos ensaios com amostras artificialmente contaminadas, foi definida uma faixa ótima de trabalho para análises quantitativas entre 0,019 e 0,090µg/L. A presença de aflatoxina M1 em 110 amostras de leite do estado de Minas Gerais foi investigada. Cinco das 27 amostras positivas na triagem por ELISA foram confirmadas por cromatografia em camada delgada.

Comparação das técnicas de cromatografia em camada delgada e ELISA na quantificação de aflatoxinas em amostras de milho

A comparação das técnicas de Enzyme Linked Immunosorbent Assay (ELISA) e cromatografia em camada delgada (CCD) por quantificação visual e densitométrica foi utilizada na determinação de aflatoxina total, em amostras de milho naturalmente contaminadas. Os teores de aflatoxina total encontrados pelas técnicas de CCD e ELISA, apresentaram maior freqüência na faixa de 0-30 mig/kg e acima de 300 mig/kg. Os resultados das amostras apresentaram coeficiente de variação concentrados abaixo de 20, 30 e 40% para a técnica de ELISA e CCD com quantificação densitométrica e visual, respectivamente. Os coeficientes de correlação foram altamente significativos para as relações entre as quantificações visual e densitométrica (r = 0,9219; t = 26,36; p < 0,001), ELISA e visual (r = 0,8277; t = 17,58; p < 0,001), ELISA e densitometria (r = 0,7373; t = 13,01; p < 0,001), na determinação de aflatoxina total em todas as amostras de milho pesquisadas, confirmando haver equivalência das técnicas estudadas.

Detecção rápida de Salmonella Enteritidis em alimentos por ensaio imunoenzimático ELISA

O método convencional de detecção de Salmonella spp., além de trabalhoso, consome longo tempo, necessitando-se normalmente de 4 a 5 dias para a confirmação da presença dessa bactéria no alimento. Portanto, o emprego de métodos rápidos e simples é importante para o diagnóstico laboratorial de toxinfecção alimentar e para o controle de qualidade. O objetivo principal deste trabalho foi a padronização de ensaio imunoenzimático-ELISA para detecção de Salmonella Enteritidis em alimentos. O ensaio utilizou anticorpos policlonais para flagelina produzidos em coelho. O anti-soro apresentou pouca reação cruzada com os sorotipos de Salmonella e as diferentes espécies de enterobactérias testadas. A sensibilidade do ensaio foi de 10(4) células/mL, quando testado em cultivo puro. O conjugado peroxidase manteve-se estável durante dois meses a 4ºC e o seu uso deve ser exclusivamente durante este tempo. O ensaio padronizado apresentou simplicidade e rapidez, com sensibilidade de 1 célula/25g de maionese de batata e cenoura, após enriquecimento em água peptonada tamponada durante 24 horas a 37°C, sem necessidade de enriquecimento seletivo.

Discriminação de sorovares de Salmonella spp. isolados de carcaças de frango por REP e ERIC-PCR e fagotipagem do sorovar Enteriditis

Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.

Detection and quantification of Roundup Ready® soybean residues in sausage samples by conventional and real-time PCR

The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.

Detection of enterotoxins produced by B. cereus through PCR analysis of ground and roasted coffee samples in Rio de Janeiro, Brazil

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.