968 resultados para PCR nested
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Genomic DNAs isolated from strains of Xylella fastidiosa that caused citrus variegated chlorosis, coffee leaf scorch, Pierce's Disease of grapevine, and plum leaf scorch were analyzed by arbitrarily primed polymerase chain reaction. Purified DNA was amplified under nonstringent conditions with single primers 21 nucleotides (nt) long. Thirty-nine amplification products were observed that were useful to distinguish among the strains and to derive a similarity matrix and construct a phenogram showing possible relationships among the strains. Strains isolated from diseased coffee and citrus in Brazil were closely related to each other (coefficient of similarity of 0.872), but only distantly related to a strain isolated from diseased grapevine in the USA (coefficient of similarity of 0.650). Strains of Xylella fastidiosa isolated from diseased plums in the USA and Brazil clustered with strains from different hosts isolated from their respective countries of origin. Thus, there may be two quite dissimilar clusters of strains of Xylella fastidiosa, one in North America and the other in South America. Each cluster contains strains that can cause disease in plum. The methods described provide a convenient and rapid method to distinguish between strains of Xylella fastidiosa that cause diseases of coffee and citrus in the same region of Brazil. This has not been possible previously. This will potentially enable the two strains to be distinguished in alternate hosts or in insect vectors.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The taxonomy of the N(2)-fixing bacteria belonging to the genus Bradyrhizobium is still poorly refined, mainly due to conflicting results obtained by the analysis of the phenotypic and genotypic properties. This paper presents an application of a method aiming at the identification of possible new clusters within a Brazilian collection of 119 Bradryrhizobium strains showing phenotypic characteristics of B. japonicum and B. elkanii. The stability was studied as a function of the number of restriction enzymes used in the RFLP-PCR analysis of three ribosomal regions with three restriction enzymes per region. The method proposed here uses Clustering algorithms with distances calculated by average-linkage clustering. Introducing perturbations using sub-sampling techniques makes the stability analysis. The method showed efficacy in the grouping of the species B. japonicum and B. elkanii. Furthermore, two new clusters were clearly defined, indicating possible new species, and sub-clusters within each detected cluster. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.
Resumo:
Objetivo: Simplificar o cálculo do índice prognóstico inflamatório nutricional (IPIN) empregando número menor de variáveis com conseqüente redução do custo da análise. Materiais e métodos: Foram estudados 54 pacientes e 12 indivíduos-controle com 48 ± 20 (média ± dp) anos de idade. As principais patologias dos pacientes eram: doença arterial periférica (22), pênfigo foliáceo (7), doença inflamatória intestinal (7), trauma (6) e pós-operatório de ortognatia (3). Foram obtidas amostras de sangue periférico, colhidas em jejum para dosagens de proteínas positivas (+) e negativas (-) de fase aguda (PFA) pelo método nefelométrico. Proteína C reativa (PCR), alfa-1-glicoproteína-ácida (alfa-1-GA), alfa-1-antitripsina (alfa-1-AT) e ceruloplasmina (CER) foram as PFA+ e albumina (Alb), transtiretina (TTR), transferrina (TF) e proteína ligadora do retinol (RBP) foram as representantes das PFA-. Esses valores foram analisados quanto à associação de correlação isolada ou associadamente na fórmula do índice prognóstico inflamatório e nutricional (IPIN = PCR + alfa-1-GA / Alb + TTR). de acordo com o índice prognóstico inflamatório e nutricional, os pacientes foram classificados em grupo-controle (G1); pacientes sem infecção/inflamação (IPIN < 1, G2) ou com risco de inflamação/infecção (IPIN > 1, G3). em seguida os pacientes do G3 foram subdivididos em baixo risco (G3A, n = 16); médio risco ( G3B, n = 10); alto risco (G3C, n = 6) e com risco de morte (G3D, n = 11). Os resultados foram correlacionados entre si (teste de Spearman) ou submetidos às comparações entre grupos (teste de Kruskall-Wallis). Resultados: Houve relação significativa entre as variáveis PCR ´ alfa-1-GA (r = 0,49), Alb ´ TTR (r = 0,60), Alb ´ RBP (r = 0,58), Alb ´ TF (r = 0,39), TTR ´ RBP (r = 0,56) e TTR´ TF (r = 0,43) e as melhores relações encontradas entre PFA+ e PFA- foram: PCR ´ Alb (r = - 0,71), PCR ´ TTR (r = - 0,54), PCR ´ TF (r = - 0,39) e alfa-1-GA ´ Alb (r = - 0,35). Os valores do IPIN mostraram a diferenciação G3 > (G1 = G2) e G3 > G3A. Entre todas as proteínas dosadas apenas PCR, Alb e TTR discriminaram os grupos: sendo G3 > (G1= G2) para PCR e G3< (G1= G2) para Alb e TTR. Apenas PCR, TTR e TF discriminaram a morbimortalidade com G3D > G3A (para PCR) e G3D < G3A (para TTR e TF). PCR/Alb e IPIN apresentaram concordância de valores para os riscos de complicações. Conclusão: Assim, conclui-se pela possibilidade de substituição do IPIN pela relação PCR/albumina, mais simples e de menor custo, mantendo-se o mesmo poder e sensibilidade para diagnóstico dos graus de risco de complicações.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Genes on the X chromosome are known to be responsible for more than 200 hereditary diseases. After IVF, the simple selection of embryo sex before uterine transfer can prevent the occurrence of affected offspring among couples at risk for these genetic disorders. The aim of this investigation was to develop a rapid method of preimplantation genetic diagnosis (PGD) using real-time polymerase chain reaction (PCR) for the sexing of human embryos, and to compare it to the fluorescence in-situ hybridization technique, considered to be the gold standard. After biopsies were obtained from 40 surplus non-viable embryos for transfer, a total of 98 blastomeres were analysed. It was possible to analyse 24 embryos (60%) by both techniques, generating a total of 70 blastomeres (35 per technique), white 28 blastomeres from 16 embryos (40%) were analysed only by real-time PCR. A rapid and safe method was developed in the present study for the sexual diagnosis of a single human cell (blastomere and buccal cell) using the emerging technology of real-time PCR. (C) 2009, Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Resumo:
Ehrlichia canis is the causative agent of canine monocytic ehrlichiosis. In order to evaluate platelet counts as a screening test for E. canis in an endemic area, 217 whole blood samples from dogs were divided into three groups: 71 non-thrombocytopenic samples (group A, platelet counts greater than 200000/muL) and 146 thrombocytopenic samples (less than 200000/muL). The thrombocytopenic group was further divided into 62 with platelet counts between 100000-200000/muL (Group B) and 84 samples with less than 100000 platelets/muL (Group C). All samples were examined for the presence of a segment of the Ehrlichia canis 16S rRNA gene using a nested polymerase chain reaction. Sixty-seven of the 217 samples (30.9%) were positive for the presence of the E. canis 16S rRNA gene; 53 (63.1%) of the group C samples and 13 (21%) of group B. Only one (1.4%) of the non-thrombocytopenic samples (Group A) was positive. These data support the concept that platelet counts may be a good screening test for canine monocytic ehrlichiosis, and that the magnitude of thrombocytopenia may increase the reliability of diagnosis.
Resumo:
In developing countries, BL has a strong association with EBV infection during childhood. In South America, the data have shown an EBV association intermediate between that reported in the United States (30%) and that in equatorial Africa (95%). Early age at EBV infection and lower socioeconomic status have been related to increased EBV-associated BL in developing countries. In Brazil, there are not enough data on childhood BL related to EBV infection. Our aim was to evaluate the clinicopathologic features and EBV association of 44 children with NHL from the state of Rio de Janeiro, situated in the southeast of Brazil. EBV was detected using RNA in situ hybridization in 36 biopsy specimens. DNA from fresh tumor samples and from paraffin-embedded tissues of patients were analyzed by PCR, in which the first reaction included primers for an EBNA-2 common region while the nested reaction amplified the region discriminating between EBV types I and 2 in separate reactions. EBV was detected in 21 of 29 BLs (72%), and type I virus infected the majority of EBV-positive BLs (18/21). There was a trend for younger age in children with EBV-positive BL compared to EBV-negative BL (median age 4 compared to 6 years, respectively; p = 0.056). Our study confirmed that in the southeast of Brazil BL had an intermediate association with EBV. A higher rate of EBV-associated BL was described in the northeast of Brazil. These differences are probably related to regional socioeconomic status. In conclusion, our study suggests that early infection with EBV in the background of a low socioeconomic condition associated with other environmental factors could contribute to BL in Brazil. (C) 2003 Wiley-Liss, Inc.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)