973 resultados para Mayo, Carlos Alberto
Resumo:
In recent decades, ceramic products have become indispensable to the technological development of humanity, occupying important positions in scientific production and consequently in industrial production. One area of the economy that continues to absorb large amounts of the products of this sector is Construction. Among the branches of the ceramic industry, there are the red ceramic industry which is traditionally the basis of that economic sector. Among the reasons for which the red ceramic industry became popular in the country, and specifically in Rio Grande do Norte, is the abundance of this raw material, easily found throughout the national territory. However, it appears that the red ceramic industry has deficiencies in technology and skilled labor, resulting in the production of ceramic goods with low added value. Among the factors that determine the quality of the ceramic products red has the proper formulation of the ceramic mass, the conformation and the firing temperature. Thus, the overall goal of this work is to study the mineralogical and technological properties, two clays from the region of the Wasteland Potiguar industrial ceramist. Therefore, the raw materials were characterized by analysis of Xray diffraction (XRD) analysis, X-ray fluorescence (XRF), particle size analysis (FA), scanning electron microscopy (SEM), optical microscopy (OM ), plasticity index (PI), thermal gravimetric analysis (TGA) and differential thermal analysis (DTA). The technological properties of the material were analyzed by water absorption tests (AA%) porosity (% PA), the linear shrinkage (RT%), apparent density (MEA), loss on ignition (PF%) and flexural strength three points (TRF)
Resumo:
The segment of the structural ceramics industry is one of the most important to the economy of Rio Grande do Norte. The supply chain makes a total of 206 companies that are distributed in 39 counties, concentrated in three regional centers: Seridó Apodi / Assu and great Natal. The ceramic industry in the state is around 80 million pieces per month, with 50,186 million of these tiles, which makes the Rio Grande do Norte one of the largest manufacturers of product in the Country. Different ceramic products can be manufactured by mixing two or more clays and accessory minerals. Mixtures acquire characteristics and form what is called the ceramic body. Refractory masses have a high melting point and thermal shock support. Its composition contains refractory clays with a little iron oxide and material fluxes. A line of semi-refractory ceramic products that stands out for its high added value are the bricks in ivory or red, used in building barbecues, fireplaces, wood stoves and braziers. The aim of this study was to use alumina-clay or silica- alumina-clay to the industrial RN, for the production of refractory bricks semi-refractory burning light. Clay and Kaolin were characterized for their chemical and mineralogical composition, immediately after ceramic bodies were made with different concentrations of the components, they were raised, pressed and sintered. After sintering the resulting products were characterized in terms of mechanical, thermal and dimensional than the characterization by X-ray diffraction and scanning electron microscopy. After obtaining the results, we concluded that the studied clay can be used for the production of semi-refractory bricks
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e bioquímicos. Sementes de milho super doce da cultivar DO-04, foram acondicionadas em sacos de papel e armazenadas por oito meses em câmara seca (40% UR). Após este período, foram colocadas para germinar em rolos de papel toalha, embebidos com GA3 nas concentrações zero; 50; 100; 150 e 200mg.L-1. Foram avaliadas a germinação, vigor e atividade amilolítica das sementes. As sementes submetidas à pré-embebição em solução de 50mg.L-1 de ácido giberélico, apresentaram maior germinação e vigor, menor teor de proteínas totais e maior atividade amilolítica.
Resumo:
The nanostructures materials are characterized to have particle size smaller than 100 nm and could reach 1 nm. Due to the extremely reduced dimensions of the grains, the properties of these materials are significantly modified relatively when compared with the conventional materials. In the present work was accomplished a study and characterization of the molybdenum carbide, seeking obtain it with particles size in the nanometers order and evaluate its potential as catalyst in the reaction of partial methane oxidation. The method used for obtaining the molybdenum carbide was starting from the precursor ammonium heptamolybdate of that was developed in split into two oven, in reactor of fixed bed, with at a heating rate of 5ºC/min, in a flow of methane and hydrogen whose flow was of 15L/h with 5% of methane for all of the samples. The studied temperatures were 350, 500, 600, 650, 660, 675 and 700ºC and were conducted for 0, 60, 120 and 180 minutes, and the percent amount and the crystallite size of the intermediate phases were determined by the Rietveld refinement method. The carbide obtained at 660ºC for 3 hours of reaction showed the best results, 24 nm. Certain the best synthesis condition, a passivating study was accomplished, in these conditions, to verify the stability of the carbide when exposed to the air. The molybdenum carbide was characterized by SEM, TEM, elemental analysis, ICP-AES, TG in atmosphere of hydrogen and TPR. Through the elemental analysis and ICP-AES the presence carbon load was verified. TG in atmosphere of hydrogen proved that is necessary the passivating of the molybdenum carbide, because occur oxidation in room temperature. The catalytic test was accomplished in the plant of Fischer-Tropsch of CTGAS, that is composed of a reactor of fixed bed. Already the catalytic test showed that the carbide presents activity for partial oxidation, but the operational conditions should be adjusted to improve the conversion
Resumo:
Actually, surveys have been developed for obtaining new materials and methodologies that aim to minimize environmental problems due to discharges of industrial effluents contaminated with heavy metals. The adsorption has been used as an alternative technology effectively, economically viable and potentially important for the reduction of metals, especially when using natural adsorbents such as certain types of clay. Chitosan, a polymer of natural origin, present in the shells of crustaceans and insects, has also been used for this purpose. Among the clays, vermiculite is distinguished by its good ion exchange capacity and in its expanded form enhances its properties by greatly increasing its specific surface. This study aimed to evaluate the functionality of the hybrid material obtained through the modification of expanded vermiculite with chitosan in the removal of lead ions (II) in aqueous solution. The material was characterized by infrared spectroscopy (IR) in order to evaluate the efficiency of modification of matrix, the vermiculite, the organic material, chitosan. The thermal stability of the material and the ratio clay / polymer was evaluated by thermogravimetry. To evaluate the surface of the material was used in scanning electron microscopy (SEM) and (BET). The BET analysis revealed a significant increase in surface area of vermiculite that after interaction with chitosan, was obtained a value of 21, 6156 m2 / g. Adsorption tests were performed according to the particle size, concentration and time. The results show that the capacity of removal of ions through the vermiculite was on average 88.4% for lead in concentrations ranging from 20-200 mg / L and 64.2% in the concentration range of 1000 mg / L. Regarding the particle size, there was an increase in adsorption with decreasing particle size. In fuction to the time of contact, was observed adsorption equilibrium in 60 minutes with adsorption capacity. The data of the isotherms were fitted to equation Freundlich. The kinetic study of adsorption showed that the pseudo second- order model best describes the adsorption adsorption, having been found following values K2=0,024 g. mg-1 min-1and Qmax=25,75 mg/g, value very close to the calculated Qe = 26.31 mg / g. From the results we can conclude that the material can be used in wastewater treatment systems as a source of metal ions adsorbent due to its high adsorption capacity
Resumo:
No Rio Grande do Sul (RS), muitas áreas sob plantio direto apresentam elevada saturação por Al e baixa saturação por bases na camada de 0,10-0,20 m (subsuperfície), e isso pode diminuir a produção de grãos de culturas anuais. O objetivo do presente trabalho foi avaliar se a ocorrência de alta saturação por Al e baixa saturação por bases em subsuperfície (0,10-0,20 m), no plantio direto, pode representar um ambiente restritivo para a produção de culturas, bem como avaliar os modos de incorporação de calcário na correção da acidez do solo em subsuperfície. Para isso, foi realizado um experimento com os cultivos de soja (2005/ 2006), milho (2006/2007), trigo (2007) e soja (2007/2008), em um Latossolo Vermelho distrófico típico (Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA), 2006) de textura franco arenosa, há quatro anos sob plantio direto, no município de Tupanciretã (RS). Os seis tratamentos foram: sem revolvimento com ou sem calcário; lavração com ou sem calcário; e escarificação com ou sem calcário. Aos 24 meses após a aplicação dos tratamentos e nas camadas de 0-0,05, 0,05-0,10, 0,10-0,15, 0,15-0,20 e 0,20-0,30 m, foram avaliados os valores de pH-H2O, saturação por Al e por bases. Avaliou-se a produtividade de soja (2005/2006), milho (2006/2007), trigo (2007) e soja (2007/2008). A acidez do solo em subsuperfície não alterou a produtividade das culturas quando as propriedades de acidez na camada de 0-0,10 m estavam em níveis em que não se recomenda a aplicação de calcário, segundo a CQFSRS/SC (2004). A incorporação de calcário com aração foi o modo mais eficiente de corrigir a acidez em profundidade.
Resumo:
Discussions about pollution caused by vehicles emission are old and have been developed along the years. The search for cleaner technologies and frequent weather alterations have been inducing industries and government organizations to impose limits much more rigorous to the contaminant content in fuels, which have an direct impact in atmospheric emissions. Nowadays, the quality of fuels, in relation to the sulfur content, is carried out through the process of hydrodesulfurization. Adsorption processes also represent an interesting alternative route to the removal of sulfur content. Both processes are simpler and operate to atmospheric temperatures and pressures. This work studies the synthesis and characterization of aluminophosphate impregnate with zinc, molybdenum or both, and its application in the sulfur removal from the gasoline through the adsorption process, using a pattern gasoline containing isooctane and thiophene. The adsorbents were characterized by x-ray diffraction, differential thermal analysis (DTG), x-ray fluorescence and scanning electron microscopy (SEM). The specific area, volume and pore diameter were determined by BET (Brunauer- Emmet-Teller) and the t-plot method. The sulfur was quantified by elementary analysis using ANTEK 9000 NS. The adsorption process was evaluated as function of the temperature variation and initial sulfur content through the adsorption isotherm and its thermodynamic parameters. The parameters of entropy (ΔS), enthalpy variation (ΔH) and free Gibbs energy (ΔG) were calculated through the graph ln(Kd) versus 1/T. Langmuir, Freundlich and Langmuir-Freundlich models were adjusted to the experimental data, and the last one had presented better results. The thermodynamic tests were accomplished in different temperatures, such as 30, 40 and 50ºC, where it was concluded the adsorption process is spontaneous and exothermic. The kinetic of adsorption was studied by 24 h and it showed that the capability adsorption to the adsorbents studied respect the following order: MoZnPO > MoPO > ZnPO > AlPO. The maximum adsorption capacity was 4.91 mg/g for MoZnPO with an adsorption efficiency of 49%.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Among the waste generated in the petrochemical industry water associated with oil production is the most important. It is considered one of the great challenges due to the presence of considered toxic chemicals present in this composition. The presence of these substances difficult to reuse the water associated with the enhanced recovery processes, so that prior to their reuse or disposal, treatment is necessary. This paper aimed to study the removal efficiency of chemical species: Ba2+, Ni2+, Cd2+, Cu2+, Cr3+, Sr2+ and Zn2+, present in the composition of the water associated with oil production by electrocoagulation. The evaluation of removal of these chemical species was performed by laboratory tests using electrochemical batch reactors and continuous flow. Initial tests were performed with electrocoagulation of synthetic wastewater in batch reactor using iron electrode. Results of removal of Zn2+ and Ni2+ were 78 % and 59 % respectively. While the percentage of removed Ba2+ was 19 % by 30 minutes of treatment and by applying current of 1.10 A. The tests were performed on effluent batch reactor applying the electrochemical technique with stainless steel electrodes 304, the objective was to remove part of the dispersed oil and also of organic compounds in the effluent. Under the experimental conditions used, the maximum result was obtained TOG was 60 % and TOC was approximately 50 % compared to the initial concentration. In the experiments carried out in continuous reactor, with effluent semisynthetic, have been used electrodes of iron and aluminum and the results were 100 % removal of Cd2+, Cu2+, Cr3+ and Zn2+ and 77 % of Sr2+. These percentages were only attainable through the use of the iron electrode. However, when the electrode was replaced by aluminum, there was a reduction in the percentage of removal to 65 %, using the same flow rate and current. Therefore according to the results obtained using the iron electrode was more effective in removing these metals and the conditions of lower current and lower flow rate was satisfactory, as observed in the experimental design adopted
Resumo:
This work aims for the evaluation of Cruzeta Irrigated Perimeter, RN, which consists in the efficient use of water for agricultural production. The goal is looking for the available quantity of water for supplying required demands for adequate and economically viable cultures for the region. It is supposed that regional community water is supplied by pipelines from sources located outside of the region. From this study it is recommended the implantation of adequate installments for culture management in accordance with the availability of water resources and others conditionings. It must be considered the intensity of rainy and drought seasons in order to adjust the cultivated area and equipments to be operated, and also, the use of operating models and simulations in order to establish alert levels and eventually, reduction of irrigated area. Based on obtained data it is proposed the cultivation of different types of non-permanent cultures so that temporary cultures would be extensively produced in periods of abundant reservoir storage water permitting the transformation of storage water in storage culture products and few or no production in severe drought periods. This is the basic premise for sustainable agricultural development for Brazilian semiarid region
Resumo:
Empirical analyses attributing the 1980s' debt crisis to inconsistent stabilization policies rest on an inappropriate long-run approach. Revising this long-run approach yields opposite results: terms of trade shocks and foreign indebtedness explain this crisis, regardless of domestic stabilization policies. This prompts us to consider a new hypothesis, of delays in trade-policy reforms, with a model in which terms-of-trade variation (under shocks) is endogenous to export structure and efficiency of resource allocation. Evidence from the structural equations model shows that allocation distortions negatively affect changes in terms of trade, which then explain this crisis. A political economy extension demonstrates that income inequality and regional trade policy determine the distortions, which in turn leads to this crisis.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The zircon mineral is widely studied in geochronology. In the case of the fission track method (FTM), the age is determined by the density of fission tracks at the zircon surface, which can be observed with an optical microscope after an appropriate chemical treatment (etching). The etching must be isotropic at the zircon grain surface to be used in the FTM, which leads those zircon grains whose etching is anisotropic to be discarded. The only reason for this discarding is the nonuniform morphology of the surface grain seen by optical microscopy, that is, no further physicochemical analysis is performed. In this work, combining micro-Raman and scanning electron microscopy (SEM) to study the etching anisotropy, it was shown that zircon grains that present at least one area at the surface where the density of fission track is uniform can be used in the FTM. The micro-Raman showed characteristic spectra of the standard zircon sample either from the areas where there are tracks or from where there are not. The only difference found was in the Raman bandwidths, which were broader for the areas with higher density of fission tracks. This suggests simply a decrease in the relative percentage of the crystalline/amorphous phases at these areas. The SEM/energy dispersive spectrometry (EDX) showed that there were no significant differences in the principal chemical composition at the areas with and without fission tracks. Copyright (c) 2008 John Wiley & Sons, Ltd.