962 resultados para Jack bean
Resumo:
Radiant spring frosts occurring during reproductive developmental stages can result in catastrophic yield loss for wheat producers. To better understand the spatial and temporal variability of frost, the occurrence and impact of frost events on rain-fed wheat production was estimated across the Australian wheatbelt for 1957–2013 using a 0.05 ° gridded weather data set. Simulated yield outcomes at 60 key locations were compared with those for virtual genotypes with different levels of frost tolerance. Over the last six decades, more frost events, later last frost day, and a significant increase in frost impact on yield were found in certain regions of the Australian wheatbelt, in particular in the South-East and West. Increasing trends in frost-related yield losses were simulated in regions where no significant trend of frost occurrence was observed, due to higher mean temperatures accelerating crop development and causing sensitive post-heading stages to occur earlier, during the frost risk period. Simulations indicated that with frost-tolerant lines the mean national yield could be improved by up to 20 through (i) reduced frost damage (~10 improvement) and (ii) the ability to use earlier sowing dates (adding a further 10 improvement). In the simulations, genotypes with an improved frost tolerance to temperatures 1 °C lower than the current 0 °C reference provided substantial benefit in most cropping regions, while greater tolerance (to 3 °C lower temperatures) brought further benefits in the East. The results indicate that breeding for improved reproductive frost tolerance should remain a priority for the Australian wheat industry, despite warming climates.
Resumo:
Diseases caused by Tobacco streak virus (TSV) have resulted in significant crop losses in sunflower and mung bean crops in Australia. Two genetically distinct strains from central Queensland, TSV-parthenium and TSV-crownbeard, have been previously described. They share only 81% total-genome nucleotide sequence identity and have distinct major alternative hosts, Parthenium hysterophorus (parthenium) and Verbesina encelioides (crownbeard). We developed and used strain-specific multiplex Polymerase chain reactions (PCRs) for the three RNA segments of TSV-parthenium and TSV-crownbeard to accurately characterise the strains naturally infecting 41 hosts species. Hosts included species from 11 plant families, including 12 species endemic to Australia. Results from field surveys and inoculation tests indicate that parthenium is a poor host of TSV-crownbeard. By contrast, crownbeard was both a natural host of, and experimentally infected by TSV-parthenium but this infection combination resulted in non-viable seed. These differences appear to be an effective biological barrier that largely restricts these two TSV strains to their respective major alternative hosts. TSV-crownbeard was seed transmitted from naturally infected crownbeard at a rate of between 5% and 50% and was closely associated with the geographical distribution of crownbeard in central Queensland. TSV-parthenium and TSV-crownbeard were also seed transmitted in experimentally infected ageratum (Ageratum houstonianum) at rates of up to 40% and 27%, respectively. The related subgroup 1 ilarvirus, Ageratum latent virus, was also seed transmitted at a rate of 18% in ageratum which is its major alternative host. Thrips species Frankliniella schultzei and Microcephalothrips abdominalis were commonly found in flowers of TSV-affected crops and nearby weed hosts. Both species readily transmitted TSV-parthenium and TSV-crownbeard. The results are discussed in terms of how two genetically and biologically distinct TSV strains have similar life cycle strategies in the same environment.
Resumo:
A quarter of Australia’s sunflower production is from the central highlands region of Queensland and is currently worth six million dollars ($AUD) annually. From the early 2000s a severe necrosis disorder of unknown aetiology was affecting large areas of sunflower crops in central Queensland, leading to annual losses of up to 20%. Other crops such as mung bean and cotton were also affected. This PhD study was undertaken to determine if the causal agent of the necrosis disorder was of viral origin and, if so, to characterise its genetic diversity, biology and disease cycle, and to develop effective control strategies. The research described in this thesis identified Tobacco streak virus (TSV; genus Ilarvirus, family Bromoviridae) as the causal agent of the previously unidentified necrosis disorder of sunflower in central Queensland. TSV was also the cause of commonly found diseases in a range of other crops in the same region including cotton, chickpea and mung bean. This was the first report from Australia of natural field infections of TSV from these four crops. TSV strains have previously been reported from other regions of Australia in several hosts based on serological and host range studies. In order to determine the relatedness of previously reported TSV strains with TSV from central Queensland, we characterised the genetic diversity of the known TSV strains from Australia. We identified two genetically distinct TSV strains from central Queensland and named them based on their major alternative hosts, TSV-parthenium from Parthenium hysterophorus and TSV-crownbeard from Verbesina encelioides. They share only 81 % total-genome nucleotide sequence identity. In addition to TSV-parthenium and TSV-crownbeard from central Queensland, we also described the complete genomes of two other ilarvirus species. This proved that previously reported TSV strains, TSV-S isolated from strawberry and TSV-Ag from Ageratum houstonianum, were actually the first record of Strawberry necrotic shock virus from Australia, and a new subgroup 1 ilarvirus, Ageratum latent virus. Our results confirmed that the TSV strains found in central Queensland were not related to previously described strains from Australia and may represent new incursions. This is the first report of the genetic diversity within subgroup 1 ilarviruses from Australia. Based on field observations we hypothesised that parthenium and crownbeard were acting as symptomless hosts of TSV-parthenium and TSV-crownbeard, respectively. We developed strain-specific multiplex PCRs for the three RNA segments to accurately characterise the range of naturally infected hosts across central Queensland. Results described in this thesis show compelling evidence that parthenium and crownbeard are the major (symptomless) alternative hosts of TSV-parthenium and TSV-crownbeard. While both TSV strains had wide natural host ranges, the geographical distribution of each strain was closely associated with the respective distribution of their major alternative hosts. Both TSV strains were commonly found across large areas of central Queensland, but we only found strong evidence for the TSV-parthenium strain being associated with major disease outbreaks in nearby crops. The findings from this study demonstrate that both TSV-parthenium and TSV-crownbeard have similar life cycles but some critical differences. We found both TSV strains to be highly seed transmitted from their respective major alternative hosts from naturally infected mother plants and survived in seed for more than 2 years. We conclusively demonstrated that both TSV strains were readily transmitted via virus-infected pollen taken from the major alternative hosts. This transmission was facilitated by the most commonly collected thrips species, Frankliniella schultzei and Microcephalothrips abdominalis. These results illustrate the importance of seed transmission and efficient thrips vector species for the effective survival of these TSV strains in an often harsh environment and enables the rapid development of TSV disease epidemics in surrounding crops. Results from field surveys and inoculation tests indicate that parthenium is a poor host of TSV-crownbeard. By contrast, crownbeard was naturally infected by, and an experimental host of TSV-parthenium. However, this infection combination resulted in non-viable crownbeard seed. These differences appear to be an effective biological barrier that largely restricts these two TSV strains to their respective major alternative hosts. Based on our field observations we hypothesised that there were differences in relative tolerance to TSV infection between different sunflower hybrids and that seasonal variation in disease levels was related to rainfall in the critical early crop stage. Results from our field trials conducted over multiple years conclusively demonstrated significant differences in tolerance to natural infections of TSV-parthenium in a wide range of sunflower hybrids. Glasshouse tests indicate the resistance to TSV-parthenium identified in the sunflower hybrids is also likely to be effective against TSV-crownbeard. We found a significant negative association between TSV disease incidence in sunflowers and accumulated rainfall in the months of March and April with increasing rainfall resulting in reduced levels of disease. Our results indicate that the use of tolerant sunflower germplasm will be a critical strategy to minimise the risk of TSV epidemics in sunflower.
Resumo:
A quarter of Australia’s sunflower production is from the central highlands region of Queensland and is currently worth six million dollars ($AUD) annually. From the early 2000s a severe necrosis disorder of unknown aetiology was affecting large areas of sunflower crops in central Queensland, leading to annual losses of up to 20%. Other crops such as mung bean and cotton were also affected. This PhD study was undertaken to determine if the causal agent of the necrosis disorder was of viral origin and, if so, to characterise its genetic diversity, biology and disease cycle, and to develop effective control strategies. The research described in this thesis identified Tobacco streak virus (TSV; genus Ilarvirus, family Bromoviridae) as the causal agent of the previously unidentified necrosis disorder of sunflower in central Queensland. TSV was also the cause of commonly found diseases in a range of other crops in the same region including cotton, chickpea and mung bean. This was the first report from Australia of natural field infections of TSV from these four crops. TSV strains have previously been reported from other regions of Australia in several hosts based on serological and host range studies. In order to determine the relatedness of previously reported TSV strains with TSV from central Queensland, we characterised the genetic diversity of the known TSV strains from Australia. We identified two genetically distinct TSV strains from central Queensland and named them based on their major alternative hosts, TSV-parthenium from Parthenium hysterophorus and TSV-crownbeard from Verbesina encelioides. They share only 81 % total-genome nucleotide sequence identity. In addition to TSV-parthenium and TSV-crownbeard from central Queensland, we also described the complete genomes of two other ilarvirus species. This proved that previously reported TSV strains, TSV-S isolated from strawberry and TSV-Ag from Ageratum houstonianum, were actually the first record of Strawberry necrotic shock virus from Australia, and a new subgroup 1 ilarvirus, Ageratum latent virus. Our results confirmed that the TSV strains found in central Queensland were not related to previously described strains from Australia and may represent new incursions. This is the first report of the genetic diversity within subgroup 1 ilarviruses from Australia. Based on field observations we hypothesised that parthenium and crownbeard were acting as symptomless hosts of TSV-parthenium and TSV-crownbeard, respectively. We developed strain-specific multiplex PCRs for the three RNA segments to accurately characterise the range of naturally infected hosts across central Queensland. Results described in this thesis show compelling evidence that parthenium and crownbeard are the major (symptomless) alternative hosts of TSV-parthenium and TSV-crownbeard. While both TSV strains had wide natural host ranges, the geographical distribution of each strain was closely associated with the respective distribution of their major alternative hosts. Both TSV strains were commonly found across large areas of central Queensland, but we only found strong evidence for the TSV-parthenium strain being associated with major disease outbreaks in nearby crops. The findings from this study demonstrate that both TSV-parthenium and TSV-crownbeard have similar life cycles but some critical differences. We found both TSV strains to be highly seed transmitted from their respective major alternative hosts from naturally infected mother plants and survived in seed for more than 2 years. We conclusively demonstrated that both TSV strains were readily transmitted via virus-infected pollen taken from the major alternative hosts. This transmission was facilitated by the most commonly collected thrips species, Frankliniella schultzei and Microcephalothrips abdominalis. These results illustrate the importance of seed transmission and efficient thrips vector species for the effective survival of these TSV strains in an often harsh environment and enables the rapid development of TSV disease epidemics in surrounding crops. Results from field surveys and inoculation tests indicate that parthenium is a poor host of TSV-crownbeard. By contrast, crownbeard was naturally infected by, and an experimental host of TSV-parthenium. However, this infection combination resulted in non-viable crownbeard seed. These differences appear to be an effective biological barrier that largely restricts these two TSV strains to their respective major alternative hosts. Based on our field observations we hypothesised that there were differences in relative tolerance to TSV infection between different sunflower hybrids and that seasonal variation in disease levels was related to rainfall in the critical early crop stage. Results from our field trials conducted over multiple years conclusively demonstrated significant differences in tolerance to natural infections of TSV-parthenium in a wide range of sunflower hybrids. Glasshouse tests indicate the resistance to TSV-parthenium identified in the sunflower hybrids is also likely to be effective against TSV-crownbeard. We found a significant negative association between TSV disease incidence in sunflowers and accumulated rainfall in the months of March and April with increasing rainfall resulting in reduced levels of disease. Our results indicate that the use of tolerant sunflower germplasm will be a critical strategy to minimise the risk of TSV epidemics in sunflower.
Resumo:
Background Studies investigating the relationship between malnutrition and post-discharge mortality following acute hip fracture yield conflicting results. This study aimed to determine whether malnutrition independently predicted 12-month post-fracture mortality after adjusting for clinically relevant covariates. Methods An ethics approved, prospective, consecutive audit was undertaken for all surgically treated hip fracture inpatients admitted to a dedicated orthogeriatric unit (November 2010–October 2011). The 12-month mortality data were obtained by a dual search of the mortality registry and Queensland Health database. Malnutrition was evaluated using the Subjective Global Assessment. Demographic (age, gender, admission residence) and clinical covariates included fracture type, time to surgery, anaesthesia type, type of surgery, post-surgery time to mobilize and post-operative complications (delirium, pulmonary and deep vein thrombosis, cardiac complications, infections). The Charlson Comorbidity Index was retrospectively applied. All diagnoses were confirmed by the treating orthogeriatrician. Results A total of 322 of 346 patients were available for audit. Increased age (P = 0.004), admission from residential care (P < 0.001), Charlson Comorbidity Index (P = 0.007), malnutrition (P < 0.001), time to mobilize >48 h (P < 0.001), delirium (P = 0.003), pulmonary embolism (P = 0.029) and cardiovascular complication (P = 0.04) were associated with 12-month mortality. Logistic regression analysis demonstrated that malnutrition (odds ratio (OR) 2.4 (95% confidence interval (CI) 1.3–4.7, P = 0.007)), in addition to admission from residential care (OR 2.6 (95% CI 1.3–5.3, P = 0.005)) and pulmonary embolism (OR 11.0 (95% CI 1.5–78.7, P = 0.017)), independently predicted 12-month mortality. Conclusions Findings substantiate malnutrition as an independent predictor of 12-month mortality in a representative sample of hip fracture inpatients. Effective strategies to identify and treat malnutrition in hip fracture should be prioritized.
Resumo:
Water availability is a major limiting factor for wheat (Triticum aestivum L.) in rain-fed agricultural systems worldwide. Root architecture has important functional implications for the timing and extent of soil water extraction, yet selection for root traits in wheat breeding programs has been largely limited due to the lack of suitable phenotyping methods. The aim of this research was to develop a low-cost high-throughput phenotyping method to facilitate selection for desirable root traits. We developed a method to assess ‘seminal root angle’ and ‘seminal root number’ in seedlings – two proxy traits associated to root architecture of mature wheat plants (1). The method involves measuring the angle between the first pair of seminal roots and the number of roots of wheat seedlings grown in transparent pots (Figure 1). Images captured at 5 to 10 days after sowing are analyzed to calculate seminal root angle and number. Performing this technique under “speed breeding” conditions (plants grown at a density of 600 plants / m2, under controlled temperature and constant light) allows the selection based on the desired root traits of up to 5 consecutive generations within 12 months. Alternatively, when focusing only on germplasm screening, up to 52 successive phenotypic assays can be conducted within 12 months. This approach has been shown to be highly reproducible, it requires little resource (time, space, and labour) and can be used to rapidly enrich breeding populations with desirable alleles for narrow root angle and a high number of seminal roots to indirectly target the selection of deeper root system with higher branching at depth. Such root characteristics are highly desirable in wheat to cope with the climate model projections, especially in summer rainfall dominant regions including some Australian, Indian, South American and African cropping regions, where winter crops mainly rely on deep stored water.
Resumo:
Temperatures have increased and in-crop rainfall decreased over recent decades in many parts of the Australian wheat cropping region. With these trends set to continue or intensify, improving crop adaptation in the face of climate change is particularly urgent in this, already drought-prone, cropping region. Importantly, improved performance under water-limitation must be achieved while retaining yield potential during more favourable seasons. A multi-trait-based approach to improve wheat yield and yield stability in the face of water-limitation and heat has been instigated in northern Australia using novel phenotyping techniques and a nested association mapping (NAM) approach. An innovative laboratory technique allows rapid root trait screening of hundreds of lines. Using soil grown seedlings, the method offers significant advantages over many other lab-based techniques. Another recently developed method allows novel stay-green traits to be quantified objectively for hundreds of genotypes in standard field trial plots. Field trials in multiple locations and seasons allow evaluation of targeted trait values and identification of superior germplasm. Traits, including yield and yield components are measured for hundreds of NAM lines in rain fed environments under various levels of water-limitation. To rapidly generate lines of interest, the University of Queensland “speed breeding” method is being employed, allowing up to 7 plant generations per annum. A NAM population of over 1000 wheat recombinant inbred lines has been progressed to the F5 generation within 18 months. Genotyping the NAM lines with the genome-wide DArTseq molecular marker system provides up to 40,000 markers. They are now being used for association mapping to validate QTL previously identified in bi-parental populations and to identify novel QTL for stay-green and root traits. We believe that combining the latest techniques in physiology, phenotyping, genetics and breeding will increase genetic progress toward improved adaptation to water-limited environments.
Resumo:
Network data packet capture and replay capabilities are basic requirements for forensic analysis of faults and security-related anomalies, as well as for testing and development. Cyber-physical networks, in which data packets are used to monitor and control physical devices, must operate within strict timing constraints, in order to match the hardware devices' characteristics. Standard network monitoring tools are unsuitable for such systems because they cannot guarantee to capture all data packets, may introduce their own traffic into the network, and cannot reliably reproduce the original timing of data packets. Here we present a high-speed network forensics tool specifically designed for capturing and replaying data traffic in Supervisory Control and Data Acquisition systems. Unlike general-purpose "packet capture" tools it does not affect the observed network's data traffic and guarantees that the original packet ordering is preserved. Most importantly, it allows replay of network traffic precisely matching its original timing. The tool was implemented by developing novel user interface and back-end software for a special-purpose network interface card. Experimental results show a clear improvement in data capture and replay capabilities over standard network monitoring methods and general-purpose forensics solutions.
Resumo:
In just one of the many extraordinary moments during the spectacular Opening Ceremony of the 2012 London Olympic Games, thirty Mary Poppinses floated into the stadium on their umbrellas to battle a 40 foot-long inflatable Lord Voldemort. This multi-million pound extravaganza was telecast to a global audience of over one billion people, highlighting in an extremely effective manner the grandeur and eccentricities of the host nation, and featuring uniquely British icons such as Mr Bean, James Bond, The Beatles and Harry Potter, as well as those quintessential icons of Englishness, the Royal Family, double-decker red buses and the National Health Service.
Resumo:
This paper examines the 2013 Australian federal election to test two competing models of vote choice: spatial politics and valence issues. Using data from the 2013 Australian Election Study, the analysis finds that spatial politics (measured by party identification and self-placement on the left-right spectrum) and valence issues both have significant effects on vote choice. However, spatial measures are more important than valence issues in explaining vote choice, in contrast with recent studies from Britain, Canada and the United States. Explanations for these differences are speculative, but may relate to Australia’s stable party and electoral system, including compulsory voting and the frequency of elections. The consequently high information burden faced by Australian voters may lead to a greater reliance on spatial heuristics than is found elsewhere.
Resumo:
Molecular oxygen (012) i8 eatabliehed to be a good electrophile' and haabean Pound to yield many interesting moleculae upon reaction with olefinic, aromatic and other mu1 tipla bonded compounda. Although, oxidation of carbon ulphur double bond (thiones) by air her bean know for a longtime, nai the r the aechaniam nor the reactive species involved in theae oxidationa have bean etabliahodo Although there is no clear experimental verification, involvement of malecular oxygen in such types of oxidationa oP activated thiocarbonyl coc pounds has been recently auggeetad.4.
Resumo:
This chapter uses data from the 2013 Australian Election Study (AES), conducted by Clive Bean, Ian McAllister, Juliet Pietsch and Rachel Gibson (Bean et al. 2014) to investigate political attitudes and voting behaviour in the election. The study was funded by the Australian Research Council and involved a national survey of political attitudes and behaviour using a self-completion questionnaire mailed to respondents on the day before the 7 September election. The sample was a systematic random sample of enrolled voters throughout Australia, drawn by the Australian Electoral Commission. Respondents were given the option of returning the completed questionnaire by reply-paid mail or completing the survey online. Non-respondents were sent several follow-up mailings and the final sample size was 3955, representing a response rate of 34 per cent. The data were weighted to reflect population parameters for gender, age, state and vote.
Resumo:
Trimeric autotransporters are a family of secreted outer membrane proteins in Gram-negative bacteria. These obligate homotrimeric proteins share a conserved C-terminal region, termed the translocation unit. This domain consists of an integral membrane β-barrel anchor and associated α-helices which pass through the pore of the barrel. The α-helices link to the extracellular portion of the protein, the passenger domain. Autotransportation refers to the way in which the passenger domain is secreted into the extracellular space. It appears that the translocation unit mediates the transport of the passenger domain across the outer membrane, and no external factors, such as ATP, ion gradients nor other proteins, are required. The passenger domain of autotransporters contains the specific activities of each protein. These are usually related to virulence. In trimeric autotransporters, the main function of the proteins is to act as adhesins. One such protein is the Yersinia adhesin YadA, found in enteropathogenic species of Yersinia. The main activity of YadA from Y. enterocolitica is to bind collagen, and it also mediates adhesion to other molecules of the extracellular matrix. In addition, YadA is involved in serum resistance, phagocytosis resistance, binding to epithelial cells and autoagglutination. YadA is an essential virulence factor of Y. enterocolitica, and removal of this protein from the bacteria leads to avirulence. In this study, I investigated the YadA-collagen interaction by studying the binding of YadA to collagen-mimicking peptides by several biochemical and biophysical methods. YadA bound as tightly to the triple-helical model peptide (Pro-Hyp-Gly)10 as to native collagen type I. However, YadA failed to bind a similar peptide that does not form a collagenous triple helix. As (Pro-Hyp-Gly)10 does not contain a specific sequence, we concluded that a triple-helical conformation is necessary for YadA binding, but no specific sequence is required. To further investigate binding determinants for YadA in collagens, I examined the binding of YadA to a library of collagen-mimicking peptides that span the entire triple-helical sequences of human collagens type II and type III. YadA bound promiscuously to many but not all peptides, indicating that a triple-helical conformation alone is not sufficient for binding. The high-binding peptides did not share a clear binding motif, but these peptides were rich in hydroxyproline residues and contained a low number of charged residues. YadA thus binds collagens without sequence specificity. This strategy of promiscuous binding may be advantageous for pathogenic bacteria. The Eib proteins from Escherichia coli are immunoglobulin (Ig)-binding homologues of YadA. I showed conclusively that recombinant EibA, EibC, EibD and EibF bind to IgG Fc. I crystallised a fragment of the passenger domain of EibD, which binds IgA in addition to IgG. The structure has a YadA-like head domain and an extended coiled-coil stalk. The top half of the coiled-coil is right-handed with hendecad periodicity, whereas the lower half is a canonical left-handed coiled-coil. At the transition from right- to left-handedness, a small β-sheet protrudes from each monomer. I was able to map the binding regions for IgG and IgA using truncations and site-directed mutagenesis to the coiled-coil stalk and identified residues critical for Ig binding.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.