Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Islands of euchromatin-like sequence and expressed polymorphic sequences within the short arm of human chromosome 21.

The goals of the human genome project did not include sequencing of the heterochromatic regions. We describe here an initial sequence of 1.1 Mb of the short arm of human chromosome 21 (HSA21p), estimated to be 10% of 21p. This region contains extensive euchromatic-like sequence and includes on average one transcript every 100 kb. These transcripts show multiple inter- and intrachromosomal copies, and extensive copy number and sequence variability. The sequencing of the "heterochromatic" regions of the human genome is likely to reveal many additional functional elements and provide important evolutionary information.

rKv1.2 overexpression in the central medial thalamic area decreases caffeine-induced arousal.

The voltage-gated potassium channel Kv1.2 belongs to the shaker-related family and has recently been implicated in the control of sleep profile on the basis of clinical and experimental evidence in rodents. To further investigate whether increasing Kv1.2 activity would promote sleep occurrence in rats, we developed an adeno-associated viral vector that induces overexpression of rat Kv1.2 protein. The viral vector was first evaluated in vitro for its ability to overexpress rat Kv1.2 protein and to produce functional currents in infected U2OS cells. Next, the adeno-associated Kv1.2 vector was injected stereotaxically into the central medial thalamic area of rats and overexpression of Kv1.2 was showed by in situ hybridization, ex vivo electrophysiology and immunohistochemistry. Finally, the functional effect of Kv1.2 overexpression on sleep facilitation was investigated using telemetry system under normal conditions and following administration of the arousing agent caffeine, during the light phase. While no differences in sleep profile were observed between the control and the treated animals under normal conditions, a decrease in the pro-arousal effect of caffeine was seen only in the animals injected with the adeno-associated virus-Kv1.2 vector. Overall, our data further support a role of the Kv1.2 channel in the control of sleep profile, particularly under conditions of sleep disturbance.

Expression of dual angiogenic/neurogenic growth factors in human primary brain tumors.

Brain tumors, benign or malignant, are characterized by a very high degree of vascularization. Recent accumulating evidence suggests that during development the neuronal wiring follows the same routes as the vasculature and that these two systems may share some of the same factors for guidance. Thus, expression of dual angiogenic/neurogenic growth factors was evaluated by in situ hybridization in human primary brain tumors of three different types, i.e., astrocytomas, oligodendrogliomas, and ependymomas, of increasing grades, in relation with the grade and type of the tumor. For this evaluation we selected vascular endothelial growth factor (VEGF-A) and its receptors VEGF-R1 and VEGF-R2 and the neuropilins 1 and 2 (NRP-1 and NRP-2), which have proangiogenic properties, platelet-derived growth factor (PDGF) receptor-beta (PDGF-Rβ), which is required for the functional maturation of blood vessels, the ephrins and their Eph receptors, angiotensinogen (AGT) and thrombospondin-2 (TSP-2), which have potential antiangiogenic properties, and netrin-1 (Net-1), which regulates vascular architecture. We show that the expression of the VEGF-NRP system, PDGF-Rβ, TSP-2, AGT, and Net-1 are differentially regulated, either increased or decreased, in relation with the type and grade of the tumor, whereas regulation of the ephrinB system does not seem to be relevant in these human brain tumors.

Phylogenetic studies in Gnaphalieae (Compositae): The genera Phagnalon Cass. and Aliella Qaiser & Lack

The precise generic delimitation of Aliella andPhagnalon, and their closest relatives within the Gnaphalieae are discussed in this review. Among the main results obtained, wehave found that the genera Aliella and Phagnalon are nested withinthe “Relhania clade” and Anisothrix, Athrixia and Pentatrichia aretheir closest relatives. Macowania is also part of the “Relhaniaclade”, whereas the subtribal affinities of Philyrophyllum liewithin the “crown radiation clade”. The monophyly of Aliellaand Phagnalon is not supported statistically. In addition,Aliella appears to be paraphylethic in most of the analysesperformed. The resulting phylogeny suggests an African origin forthe ancestor of Aliella and Phagnalon and identifies three mainclades within Phagnalon that constitute the following naturalgroups on a geographic basis: (1) the Irano-Turanian clade; (2) the Mediterranean-Macaronesian clade; and (3) the Yemen-Ethiopian clade. Some endemics to Yemen and Ethiopia appeared merged in the Mediterranean-Macaronesian clade, providing new evidence of the phytogeographical links betweenMacaronesia, Eastern Africa and Southern Arabia. Incongruities between thechloroplast and nuclear molecular data and the lack of resolution in some clades mayindicate that hybridization could have played an important role in the evolution anddiversification of both Phagnalon and Aliella.

The frequency and prognostic impact of dic(9;20)(p13.2;q11.2) in childhood B-cell precursor acute lymphoblastic leukemia: results from the NOPHO ALL-2000 trial.

The dic(9;20)(p13.2;q11.2) is reported to be present in ∼2% of childhood B-cell precursor acute lymphoblastic leukemia (BCP ALL). However, it easily escapes detection by G-banding analysis and its true prevalence is hence unknown. We performed interphase fluorescence in situ hybridization analyses-in a three-step manner-using probes for: (i) CDKN2A at 9p21, (ii) 20p and 20q subtelomeres and (iii) cen9 and cen20. Out of 1033 BCP ALLs diagnosed from 2001 to 2006, 533 were analyzed; 16% (84/533) displayed 9p21 deletions, of which 30% (25/84) had dic(9;20). Thus, dic(9;20)-positivity was found in 4.7% (25/533), making it the third most common genetic subgroup after high hyperdiploidy and t(12;21)(p13;q22). The dic(9;20) was associated with a female predominance and an age peak at 3 years; 18/25 (72%) were allocated to non-standard risk treatment at diagnosis. Including cases detected by G-banding alone, 29 dic(9;20)-positive cases were treated according to the NOPHO ALL 2000 protocol. Relapses occurred in 24% (7/29) resulting in a 5-year event-free survival of 0.69, which was significantly worse than for t(12;21) (0.87; P=0.002) and high hyperdiploidy (0.82; P=0.04). We conclude that dic(9;20) is twice as common as previously surmised, with many cases going undetected by G-banding analysis, and that dic(9;20) should be considered a non-standard risk abnormality.

Contribution à l'étude neuroanatomique de systèmes enzymatiques impliqués dans le métabolisme énergétique cérébral

RESUME Il a longtemps été admis que le glucose était le principal, sinon le seul substrat du métabolisme énergétique cérébral. Néanmoins, des études récentes indiquent que dans des situations particulières, d'autres substrats peuvent être employés. C'est le cas des monocarboxylates (lactate et pyruvate principalement). Bien que la barrière hématoencéphalique soit peu perméable à ces molécules, elles deviennent néanmoins des substrats possibles si elles sont produites localement. Les deux systèmes enzymatiques pivots des voies glycolytiques et oxydatives sont la lactate déshydrogénase (LDH, EC 1.1.1.27) qui catalyse l'interconversion du pyruvate et du lactate et le complexe pyruvate déshydrogénase qui catalyse la conversion irréversible du pyruvate en acétyl-CoA qui entre dans la respiration mitochondriale. Nous avons étudié la localisation, tant régionale que cellulaire, des isoformes LDH-1, LDH-5 et PDHEla dans le cerveau du chat et dé l'homme au moyen de diverses techniques histologiques. Dans un premier temps, des investigations par hybridation in situ au moyen d'oligosondes marquées au 33P sur de coupes de cerveau de chat ont permis de montrer une différence de l'expression des enzymes à vocation oxydative (LDH-1 et PDHA1, le gène codant pour la protéine PDHEIa) par rapport à LDH-5, isoforme qui catalyse préférentiellement la formation de lactate. LDH-1 et PDHA 1 ont des distributions similaires et sont enrichies dans de nombreuses structures cérébrales, comme l'hippocampe, de nombreux noyaux thalamiques et des structures pontiques. Le cortex cérébral exhibe également une expression importante de LDH-1 et PDH. LDH-5 a par contre une expression largement plus diffuse à travers le cerveau, bien que l'on trouve néanmoins un enrichissement plus important dans l'hippocampe. Ces résultats sont en accord avec les observations que nous avons précédemment publiées chez le rongeur pour LDH-1 et LDH-5 (Laughton et collaborateurs, 2000). Des analyses par PCR en temps réel ont confirmé que dans certaines régions, LDH-1 est exprimée de façon nettement plus importante que LDH-5. Dans un deuxième temps, nous avons appliqué sur des coupes histologiques d'hippocampe et de cortex occipital humain post-mortem des anticorps monoclonaux spécifiques de l'isoforme LDH-5 et la sous-unité PDHela du complexe pyruvate déshydrogénase. Là aussi, les immunoréactions révèlent une ségrégation régionale mais aussi cellulaire des deux enzymes. Dans les deux régions étudiées, LDH-5 est localisée exclusivement dans les astrocytes. Dans le cortex occipital, la matière blanche et également la couche I corticale sont immunopositives pour LDH-5. Dans l'hippocampe, le CA4 et l'alveus exhibe l'immunomarquage le plus intense pour LDH-5. Seuls des neurones (à de rares exceptions quelques astrocytes) sont immunopositifs à l'anticorps monoclonal dirigé contre PDHela. La couche IV du cortex occipital présente la plus forte immunoréaction. Dans l'hippocampe, une immunoréactivité est observée dans le stratum granulosum et à travers la région CA1 jusqu'à la région CA3. L'ensemble de ces résultats montre une hétérogénéité métabolique dans le cerveau et étaye l'hypothèse "astrocyte-neurone lactate shuttle" (ANL5) (Bittar et collaborateurs, 1996; Magistretti et Pellerin, 1999) qui propose que les astrocytes fournissent aux neurones activés du lactate comme substrat alternatif de leur métabolisme énergétique. ABSTRACT For a long time now, glucose has been thought to be the main, if not the sole substrate for brain energy metabolism. Recent data nevertheless suggest that other molecules, such as monocarboxylates (lactate and pyruvate mainly) could be suitable substrates. Although monocarboxylates poorly cross the blood brain barrier (BBB), such substrates could replace glucose if produced locally. The two key enzymatic systems required for the use and production of these substats are lactate dehydrogenase (LDH; EC 1.1.1.27) that catalyses the interconversion of lactate and pyruvate and the pyruvate dehydrogenase complex that irreversibly funnels pyruvate towards the mitochondrial TCA cycle and oxydative phosphorylation. Our study consisted in localizing these different systems with various histochemical procedures in the cat brain and two regions, i.e. hippocampus and primary visual cortex, of the human brain. First, by means of in situ hybridization with 33P labeled oligoprobes, we have demonstrated that the more oxidative enzymes (LDH-1 and PDHA1, the gene coding for PDHEla) are highly expressed in a variety of feline brain structures. These structures include the hippocampus, various thalamic nuclei and the pons. The cerebral cortex exhibits also a high LDH-1 and PDHAl expression. On the other hand, LDH-5 expression is poorer and more diffuse, although the hippocampus does seem to have a higher expression. These fmdings are consistent with our previous observation of the expression of LDH1 and LDH-5 in the rodent brain (Laughton et al, 2000). Real-time PCR (TagMan tm) revealed that, in various regions, LDH-1 is effectively more highly expressed than LDH-5. In a second set of experiments, monoclonal antibodies to LDH-5 and PDHeIa were applied to cryostat sections of post-mortem human hippocampus and occipital cortex. These procedures revealed not only that the two enzymes have different regional distributions, but also distinct cellular localisation. LDH-5 immunoreactivity is solely observed in astrocytes. In the occipital cortex, the white matter and layer I are immunopositive. In the hippocampus, the alveus and CA4 show LDH-5 immunoréactivity. PDHeIa has been detected, with few exceptions, only in neurons. Layer IV of the occipital cortex was most immmunoreactive. In the hippocampus, PDHela immunoreactivity is noticed in the stratum granulosum and through CA 1 to CA3 areas. The overall observations made in this study show that there is a metabolic heterogeneity in the brain and our findings support the hypothesis of an astrocyte-neuron lactate shuttle (ANLS)(Bittar et al., 1996; Magistretti & Pellerin, 1999) where astrocytes export to active neurons lactate to fuel their energy demands.

Roles of transient guidepost neurons in corpus callosum formation and guidance

RESUMENeurones transitoires jouant un rôle de cibles intermédiaires dans le guidage des axones du corps calleuxLe guidage axonal est une étape clé permettant aux neurones d'établir des connexions synaptiques et de s'intégrer dans un réseau neural fonctionnel de manière spécifique. Des cellules-cibles intermédiaires appelées « guidepost » aident les axones à parcourir de longues distances dans le cerveau en leur fournissant des informations directionnelles tout au long de leur trajet. Il a été démontré que des sous-populations de cellules gliales au niveau de la ligne médiane guident les axones du corps calleux (CC) d'un hémisphère vers l'autre. Bien qu'il fût observé que le CC en développement contenait aussi des neurones, leur rôle était resté jusqu'alors inconnu.La publication de nos résultats a montré que pendant le développement embryonnaire, le CC contient des glies mais aussi un nombre considérable de neurones glutamatergiques et GABAergiques, nécessaires à la formation du corps calleux (Niquille et al., PLoS Biology, 2009). Dans ce travail, j'ai utilisé des techniques de morphologie et d'imagerie confocale 3D pour définir le cadre neuro-anatomique de notre modèle. De plus, à l'aide de transplantations sur tranches in vitro, de co-explants, d'expression de siRNA dans des cultures de neurones primaires et d'analyse in vivo sur des souris knock-out, nous avons démontré que les neurones du CC guident les axones callosaux en partie grâce à l'action attractive du facteur de guidage Sema3C sur son récepteur Npn- 1.Récemment, nous avons étudié l'origine, les aspects dynamiques de ces processus, ainsi que les mécanismes moléculaires impliqués dans la mise en place de ce faisceau axonal (Niquille et al., soumis). Tout d'abord, nous avons précisé l'origine et l'identité des neurones guidepost GABAergiques du CC par une étude approfondie de traçage génétique in vivo. J'ai identifié, dans le CC, deux populations distinctes de neurones GABAergiques venant des éminences ganglionnaires médiane (MGE) et caudale (CGE). J'ai ensuite étudié plus en détail les interactions dynamiques entre neurones et axones du corps calleux par microscopie confocale en temps réel. Puis nous avons défini le rôle de chaque sous-population neuronale dans le guidage des axones callosaux et de manière intéressante les neurones GABAergic dérivés de la MGE comme ceux de la CGE se sont révélés avoir une action attractive pour les axones callosaux dans des expériences de transplantation. Enfin, nous avons clarifié la base moléculaire de ces mécanismes de guidage par FACS sorting associé à un large criblage génétique de molécules d'intérêt par une technique très sensible de RT-PCR et ensuite ces résultats ont été validés par hybridation in situ.Nous avons également étudié si les neurones guidepost du CC étaient impliqués dans son agénésie (absence de CC), présente dans nombreux syndromes congénitaux chez 1 humain. Le gène homéotique Aristaless (Arx) contrôle la migration des neurones GABAergiques et sa mutation conduit à de nombreuses pathologies humaines, notamment la lissencéphalie liée à IX avec organes génitaux anormaux (XLAG) et agénésie du CC. Fait intéressant, nous avons constaté qu'ARX est exprimé dans toutes les populations GABAergiques guidepost du CC et que les embryons mutant pour Arx présentent une perte drastique de ces neurones accompagnée de défauts de navigation des axones (Niquille et al., en préparation). En outre, nous avons découvert que les souris déficientes pour le facteur de transcription ciliogenic RFX3 souffrent d'une agénésie du CC associé avec des défauts de mise en place de la ligne médiane et une désorganisation secondaire des neurones glutamatergiques guidepost (Benadiba et al., submitted). Ceci suggère fortement l'implication potentielle des deux types de neurones guidepost dans l'agénésie du CC chez l'humain.Ainsi, mon travail de thèse révèle de nouvelles fonctions pour ces neurones transitoires dans le guidage axonal et apporte de nouvelles perspectives sur les rôles respectifs des cellules neuronales et gliales dans ce processus.ABSTRACTRole of transient guidepost neurons in corpus callosum development and guidanceAxonal guidance is a key step that allows neurons to build specific synaptic connections and to specifically integrate in a functional neural network. Intermediate targets or guidepost cells act as critical elements that help to guide axons through long distance in the brain and provide information all along their travel. Subpopulations of midline glial cells have been shown to guide corpus callosum (CC) axons to the contralateral cerebral hemisphere. While neuronal cells are also present in the developing corpus callosum, their role still remains elusive.Our published results unravelled that, during embryonic development, the CC is populated in addition to astroglia by numerous glutamatergic and GABAergic guidepost neurons that are essential for the correct midline crossing of callosal axons (Niquille et al., PLoS Biology, 2009). In this work, I have combined morphological and 3D confocal imaging techniques to define the neuro- anatomical frame of our system. Moreover, with the use of in vitro transplantations in slices, co- explant experiments, siRNA manipulations on primary neuronal culture and in vivo analysis of knock-out mice we have been able to demonstrate that CC neurons direct callosal axon outgrowth, in part through the attractive action of Sema3C on its Npn-1 receptor.Recently, we have studied the origin, the dynamic aspects of these processes as well as the molecular mechanisms involved in the establishment of this axonal tract (Niquille et al., submitted). First, we have clarified the origin and the identity of the CC GABAergic guidepost neurons using extensive in vivo cell fate-mapping experiments. We identified two distinct GABAergic neuronal subpopulations, originating from the medial (MGE) and caudal (CGE) ganglionic eminences. I then studied in more details the dynamic interactions between CC neurons and callosal axons by confocal time-lapse video microscopy and I have also further characterized the role of each guidepost neuronal subpopulation in callosal guidance. Interestingly, MGE- and CGE-derived GABAergic neurons are both attractive for callosal axons in transplantation experiments. Finally, we have dissected the molecular basis of these guidance mechanisms by using FACS sorting combined with an extensive genetic screen for molecules of interest by a sensitive RT-PCR technique, as well as, in situ hybridization.I have also investigated whether CC guidepost neurons are involved in agenesis of the CC which occurs in numerous human congenital syndromes. Aristaless-related homeobox gene (Arx) regulates GABAergic neuron migration and its mutation leads to numerous human pathologies including X-linked lissencephaly with abnormal genitalia (XLAG) and severe CC agenesis. Interestingly, I found that ARX is expressed in all the guidepost GABAergic neuronal populations of the CC and that Arx-/- embryos exhibit a drastic loss of CC GABAergic interneurons accompanied by callosal axon navigation defects (Niquille et al, in preparation). In addition, we discovered that mice deficient for the ciliogenic transcription factor RFX3 suffer from CC agenesis associated with early midline patterning defects and a secondary disorganisation of guidepost glutamatergic neurons (Benadiba et al., submitted). This strongly points out the potential implication of both types of guidepost neurons in human CC agenesis.Taken together, my thesis work reveals novel functions for transient neurons in axonal guidance and brings new perspectives on the respective roles of neuronal and glial cells in these processes.

Expression of genes encoding the pre-TCR and CD3 complex during thymus development.

The mature TCR is composed of a clonotypic heterodimer (alpha beta or gamma delta) associated with the invariant CD3 components (gamma, delta, epsilon and zeta). There is now considerable evidence that more immature forms of the TCR-CD3 complex (consisting of either CD3 alone or CD3 associated with a heterodimer of TCR beta and pre-T alpha) can be expressed at the cell surface on early thymocytes. These pre-TCR complexes are believed to be necessary for the ordered progression of early T cell development. We have analyzed in detail the expression of both the pre-TCR and CD3 complex at various stages of adult thymus development. Our data indicate that all CD3 components are already expressed at the mRNA level by the earliest identifiable (CD4lo) thymic precursor. In contrast, genes encoding the pre-TCR complex (pre-T alpha and fully rearranged TCR beta) are first expressed at the CD44loCD25+CD4-CD8- stage. Detectable surface expression of both CD3 and TCR beta are delayed relative to expression of the corresponding genes, suggesting the existence of other (as yet unidentified) components of the pre-TCR complex.

Subplate subpopulations in the hypoxic-ischemic neonatal rat brain

Subplate neurons are among the earliest born cells of the neocortex and play a fundamental role in cortical development, in particular in the formation of thalamocortical connections. Subplate abnormalities have been described in several neuropathological disorders including schizophrenia, autism and periventricular eukomalacia (Eastwood and Harrison, Schizophr Res, 79, 2005; McQuillen and Ferriero, Brain Pathol, 15, 2005). We have identified and confirmed a range of specific markers for murine subplate using a microarray based approach and found that different subplate subpopulations are characterized by distinct expression patterns of these genes (Hoerder-Suabedissen et al., Cereb Cortex, 19, 2009). In this current study, we are making use of these markers to investigate neuropathological changes of the subplate after cerebral hypoxia-ischemia (HI) in the neonatal rat. First, we characterized the expression of a number of murine subplate markers in the postnatal rat using immunohistochemistry and in situ hybridization. While several genes (Nurr1, Cplx3, Ctgf and Tmem163) presented very similar expression patterns as in the mouse, others (Ddc, MoxD1 and TRH) were completely absent in the rat cortex. This finding suggests important differences in the subplate populations of these two rodent species. In a neonatal rat model of HI, selective vulnerability of subplate has been suggested using BrdU birthdating methods (McQuillen et al., J Neurosci, 15, 2003). We hypothesized that certain subplate subpopulations could be more susceptible than others and analyzed the above subplate markers in a similar yet slightly milder HI model. Two-day old male rat pups underwent permanent occlusion of the right common carotid artery followed by a period of hypoxia (6% O2, 1.5h or 2h) and were analyzed six days later. Preliminary counts on three subplate subpopulations (Nurr1+, Cplx3+ and Ctgf+ cells, respectively) showed similar reductions in cell numbers for all three groups. In addition, we found that the majority of cases which show changes in the subplate also exhibit lesions in the deep cortical layers VI (identified by FoxP2 expression) and sometimes even layer V (revealed by Er81 immunoreactivity), which questions the selective susceptibility of subplate over other cortical layers under the conditions we used in our model. Supported by MRC, FMO holds a Berrow Scholarship, Lincoln College, Oxford.

Differential neuroglycan C expression during retinal degeneration in Rpe65-/- mice.

PURPOSE: An increased mRNA expression of the genes coding for the extracellular matrix proteins neuroglycan C (NGC), interphotoreceptor matrix proteoglycan 2 (IMPG2), and CD44 antigen (CD44) has been observed during retinal degeneration in mice with a targeted disruption of the Rpe65 gene (Rpe65-/- mouse). To validate these data, we analyzed this differential expression in more detail by characterizing retinal NGC mRNA isoform and protein expression during disease progression. METHODS: Retinas from C57/Bl6 wild-type and Rpe65-/- mice, ranging 2 to 18 months of age, were used. NGC, IMPG2, and CD44 mRNA expression was assessed by oligonucleotide microarray, quantitative PCR, and in situ hybridization. Retinal NGC protein expression was analyzed by western blot and immunohistochemistry. RESULTS: As measured by quantitative PCR, mRNA expression of NGC and CD44 was induced by about 2 fold to 3 fold at all time points in Rpe65-/- retinas, whereas initially 4 fold elevated IMPG2 mRNA levels progressively declined. NGC and IMPG2 mRNAs were expressed in the ganglion cell layer, the inner nuclear layer, and at the outer limiting membrane. NGC mRNA was also detected in retinal pigment epithelium cells (RPE), where its mRNA expression was not induced during retinal degeneration. NGC-I was the major isoform detected in the retina and the RPE, whereas NGC-III was barely detected and NGC-II could not be assessed. NGC protein expression was at its highest levels on the apical membrane of the RPE. NGC protein levels were induced in retinas from 2- and 4-month-old Rpe65-/- mice, and an increased amount of the activity-cleaved NGC ectodomain containing an epidermal growth factor (EGF)-like domain was detected. CONCLUSIONS: During retinal degeneration in Rpe65-/- mice, NGC expression is induced in the neural retina, but not in the RPE, where NGC is expressed at highest levels.

Stomatal analysis of citrus somatic hybrids obtained by protoplast fusion

The objective of this work was to evaluate leaf epidermis morphological characteristics of three citrus somatic hybrids, compared to their parents. Parental and somatic hybrid young leaves were collected and processed for scanning electron microscope observations. Citrus polyploid hybrids have fewer stomata per area and these are larger compared to their diploid parental parents. No differences in internal arrangement of the stomatal cells were detected between parental plants and somatic hybrids. Additional studies may determine if these differences will influence physiological behavior of the plants in the field.

A new green fluorescent protein-based bacterial biosensor for analysing phenanthrene fluxes.

The polycyclic aromatic hydrocarbon (PAH)-degrading strain Burkholderia sp. RP007 served as host strain for the design of a bacterial biosensor for the detection of phenanthrene. RP007 was transformed with a reporter plasmid containing a transcriptional fusion between the phnS putative promoter/operator region and the gene encoding the enhanced green fluorescent protein (GFP). The resulting bacterial biosensor--Burkholderia sp. strain RP037--produced significant amounts of GFP after batch incubation in the presence of phenanthrene crystals. Co-incubation with acetate did not disturb the phenanthrene-specific response but resulted in a homogenously responding population of cells. Active metabolism was required for induction with phenanthrene. The magnitude of GFP induction was influenced by physical parameters affecting the phenanthrene flux to the cells, such as the contact surface area between solid phenanthrene and the aqueous phase, addition of surfactant, and slow phenanthrene release from Model Polymer Release System beads or from a water-immiscible oil. These results strongly suggest that the bacterial biosensor can sense different phenanthrene fluxes while maintaining phenanthrene metabolism, thus acting as a genuine sensor for phenanthrene bioavailability. A relationship between GFP production and phenanthrene mass transfer is proposed.

Notch1 is required for neuronal and glial differentiation in the cerebellum.

The mechanisms that guide progenitor cell fate and differentiation in the vertebrate central nervous system (CNS) are poorly understood. Gain-of-function experiments suggest that Notch signaling is involved in the early stages of mammalian neurogenesis. On the basis of the expression of Notch1 by putative progenitor cells of the vertebrate CNS, we have addressed directly the role of Notch1 in the development of the mammalian brain. Using conditional gene ablation, we show that loss of Notch1 results in premature onset of neurogenesis by neuroepithelial cells of the midbrain-hindbrain region of the neural tube. Notch1-deficient cells do not complete differentiation but are eliminated by apoptosis, resulting in a reduced number of neurons in the adult cerebellum. We have also analyzed the effects of Notch1 ablation on gliogenesis in vivo. Our results show that Notch1 is required for both neuron and glia formation and modulates the onset of neurogenesis within the cerebellar neuroepithelium.

Long-distance wolf recolonization of France and Switzerland inferred from non-invasive genetic sampling over a period of 10 years

In the early 1900s, the wolf (Canis lupus) was extirpated from France and Switzerland. There is growing evidence that the species is presently recolonizing these countries in the western Alps. By sequencing the mitochondrial DNA (mtDNA) control region of various samples mainly collected in the field (scats, hairs, regurgitates, blood or tissue; n = 292), we could (1) develop a non-invasive method enabling the unambiguous attribution of these samples to wolf, fox (Vulpes vulpes) or dog (Canis familiaris), among others; (2) demonstrate that Italian, French and Swiss wolves share the same mtDNA haplotype, a haplotype that has never been found in any other wolf population world-wide. Combined together, field and genetic data collected over 10 years corroborate the scenario of a natural expansion of wolves from the Italian source population. Furthermore, such a genetic approach is of conservation significance, since it has important consequences for management decisions. This first long-term report using non-invasive sampling demonstrates that long-distance dispersers are common, supporting the hypothesis that individuals may often attempt to colonize far from their native pack, even in the absence of suitable corridors across habitats characterized by intense human activities.