Increased B-lymphopoiesis by interleukin 7 induces bone loss in mice with intact ovarian function: Similarity to estrogen deficiency

Estrogen deficiency caused by ovariectomy (OVX) results in a marked bone loss due to stimulated bone resorption by osteoclasts. During our investigations of the pathogenesis of bone loss in estrogen deficiency, we found that OVX selectively stimulates B-lymphopoiesis which results in marked accumulation of B220-positive pre-B cells in mouse bone marrow. To examine the possible correlation between stimulated B-lymphopoiesis and bone loss, 8-week-old female mice were treated with interleukin (IL) 7, which stimulates B-lymphopoiesis in bone marrow. We also examined bone mass in IL-7 receptor-knockout mice that exhibit marked suppression of B-lymphopoiesis in the bone marrow. The increased B-lymphopoiesis induced by IL-7 administration resulted in marked bone loss by stimulation of osteoclastic bone resorption in mice with intact ovarian function. The changes in both B-lymphopoiesis and bone mass in IL-7-treated female mice were similar to those in age-matched OVX mice. In contrast, the trabecular bone volume of the femur was greatly increased in both female and male IL-7 receptor-knockout mice when compared with the respective wild-type and heterozygous littermates. These results show that the perturbation of B-lymphopoiesis in the bone marrow is closely linked to the change in bone mass. We propose here that the increased B-lymphopoiesis due to estrogen deficiency is involved in the mechanism of stimulated bone resorption.

IL-18, although antiallergic when administered with IL-12, stimulates IL-4 and histamine release by basophils

IL-18 is a proinflammatory cytokine that plays an important role in natural killer cell activation and T helper 1 (Th1) cell responses. Mast cells and basophils are major inducers and effectors of allergic inflammation. Here we show that basophils and mast cells derived by culture of bone marrow cells with IL-3 for 10 days express IL-18Rα chain and that basophils produce large amounts of IL-4 and IL-13 in response to stimulation with IL-3 and IL-18. Injection of IL-12 and IL-18 inhibits IgE production in helminth-infected wild-type mice and abolishes the capacity of their basophils to produce IL-4 and IL-13 in response to stimulation either with IL-3 and IL-18 or with FcɛR cross-linkage. By contrast, this combination of cytokines actually increases IgE levels in helminth-infected IFN-γ−/− mice and enhances IL-4 and IL-13 production by their basophils. Furthermore, injection of IL-18 alone enhances basophil production of IL-4 and histamine both in wild-type and IFN-γ−/− mice. Thus, IL-18 has the potential to stimulate basophils but, when given with IL-12, exhibits an antiallergic action in vivo.

Impaired osteoclastic bone resorption leads to osteopetrosis in cathepsin-K-deficient mice

Cathepsin K is a recently identified lysosomal cysteine proteinase. It is abundant in osteoclasts, where it is believed to play a vital role in the resorption and remodeling of bone. Pycnodysostosis is a rare inherited osteochondrodysplasia that is caused by mutations of the cathepsin-K gene, characterized by osteosclerosis, short stature, and acroosteolysis of the distal phalanges. With a view to delineating the role of cathepsin K in bone resorption, we generated mice with a targeted disruption of this proteinase. Cathepsin-K-deficient mice survive and are fertile, but display an osteopetrotic phenotype with excessive trabeculation of the bone-marrow space. Cathepsin-K-deficient osteoclasts manifested a modified ultrastructural appearance: their resorptive surface was poorly defined with a broad demineralized matrix fringe containing undigested fine collagen fibrils; their ruffled borders lacked crystal-like inclusions, and they were devoid of collagen-fibril-containing cytoplasmic vacuoles. Assaying the resorptive activity of cathepsin-K-deficient osteoclasts in vitro revealed this function to be severely impaired, which supports the contention that cathepsin K is of major importance in bone remodeling.

RANK is the intrinsic hematopoietic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism

We have generated RANK (receptor activator of NF-κB) nullizygous mice to determine the molecular genetic interactions between osteoprotegerin, osteoprotegerin ligand, and RANK during bone resorption and remodeling processes. RANK−/− mice lack osteoclasts and have a profound defect in bone resorption and remodeling and in the development of the cartilaginous growth plates of endochondral bone. The osteopetrosis observed in these mice can be reversed by transplantation of bone marrow from rag1−/− (recombinase activating gene 1) mice, indicating that RANK−/− mice have an intrinsic defect in osteoclast function. Calciotropic hormones and proresorptive cytokines that are known to induce bone resorption in mice and human were administered to RANK−/− mice without inducing hypercalcemia, although tumor necrosis factor α treatment leads to the rare appearance of osteoclast-like cells near the site of injection. Osteoclastogenesis can be initiated in RANK−/− mice by transfer of the RANK cDNA back into hematopoietic precursors, suggesting a means to critically evaluate RANK structural features required for bone resorption. Together these data indicate that RANK is the intrinsic cell surface determinant that mediates osteoprotegerin ligand effects on bone resorption and remodeling as well as the physiological and pathological effects of calciotropic hormones and proresorptive cytokines.

Developmental plasticity of CNS microglia

Microglia arise from CD45+ bone marrow precursors that colonize the fetal brain and play a key role in central nervous system inflammatory conditions. We report that parenchymal microglia are uncommitted myeloid progenitors of immature dendritic cells and macrophages by several criteria, including surface expression of “empty” class II MHC protein and their cysteine protease (cathepsin) profile. Microglia express receptors for stem cell factor and can be skewed toward more dendritic cell or macrophage-like profiles in response to the lineage growth factors granulocyte/macrophage colony-stimulating factor or macrophage colony-stimulating factor. Thus, in contrast to other organs, where terminally differentiated populations of resident dendritic cells and/or macrophages outnumber colonizing precursors, the majority of microglia within the brain remain in an undifferentiated state.

Synergistic up-regulation of the myeloid-specific promoter for the macrophage colony-stimulating factor receptor by AML1 and the t(8;21) fusion protein may contribute to leukemogenesis.

AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.

Interleukin 7 independent development of human B cells.

Mammalian hematopoietic stem cell (HSC) commitment and differentiation into lymphoid lineage cells proceed through a series of developmentally restricted progenitor compartments. A complete understanding of this process, and how it differs from HSC commitment and differentiation into cells of the myeloid/erythroid lineages, requires the development of model systems that support HSC commitment to the lymphoid lineages. We now describe a human bone marrow stromal cell culture that preferentially supports commitment and differentiation of human HSC to CD19+ B-lineage cells. Fluorescence activated cell sorterpurified CD34++/lineage-cells were isolated from fetal bone marrow and cultured on human fetal bone marrow stromal cells in serum-free conditions containing no exogenous cytokines. Over a period of 3 weeks, CD34++/lineage- cells underwent commitment, differentiation, and expansion into the B lineage. Progressive changes included: loss of CD34, acquisition of and graded increases in the level of cell surface CD19, and appearance of immature B cells expressing mu/kappa or mu/lambda cell surface Ig receptors. The tempo and phenotype of B-cell development was not influenced by the addition of IL-7 (10 ng/ml), or by the addition of goat anti-IL-7 neutralizing antibody. These results indicate a profound difference between mouse and human in the requirement for IL-7 in normal B-cell development, and provide an experimental system to identify and characterize human bone marrow stromal cell-derived molecules crucial for human B lymphopoiesis.

Proliferation of multipotent hematopoietic cells controlled by a truncated erythropoietin receptor transgene.

The long-term efficacy of gene therapy using bone marrow transplantation requires the engraftment of genetically altered totipotent hematopoietic stem cells (THSCs). Ex vivo expansion of corrected THSCs is one way to increase the efficiency of the procedure. Similarly, selective in vivo expansion of the therapeutic THSCs rather than the endogenous THSCs could favor the transplant. To test whether a conferred proliferative advantage gene can facilitate the in vitro and in vivo expansion of hematopoietic stem cells, we have generated transgenic mice expressing a truncated receptor for the growth factor erythropoietin. These mice are phenotypically normal, but when treated in vivo with exogenous erythropoietin they exhibit a marked increase in multipotent, clonogenic hematopoietic cells [colony-forming units in the spleen (CFU-S) and CFUs that give rise to granulocytes, erythroid cells, macrophages, and megakaryocytes within the same colony (CFU-GEMM)] in comparison with the wild-type mice. In addition, long-term in vitro culture of tEpoR transgenic bone marrow in the presence of erythropoietin induces exponential expansion of trilineage hematopoietic stem cells not seen with wild-type bone marrow. Thus, the truncated erythropoietin receptor gene shows promise as a means for obtaining cytokine-inducible hematopoietic stem cell proliferation to facilitate the direct targeting of THSCs and to provide a competitive repopulation advantage for transplanted therapeutic stem cells.

Long-term culture of lymphohematopoietic stem cells.

Pluripotent hematopoietic stem cells (PHSCs) show self-renewal and give rise to all blood cell types. The extremely low number of these cells in primary hematopoietic organs and the lack of culture systems that support proliferation of undifferentiated PHSCs have precluded the study of both the biology of these cells and their clinical application. We describe here cell lines and clones derived from PHSCs that were established from hematopoietic cells from the fetal liver or bone marrow of normal and p53-deficient mice with a combination of four growth factors. Most cell lines were Sca-1+, c-Kit+, PgP-1+, HSA+, and Lin- (B-220-, Joro 75-, 8C5-, F4/80-, CD4-, CD8-, CD3-, IgM-, and TER 119-negative) and expressed three new surface markers: Joro 177, Joro 184, and Joro 96. They did not synthesize RNA transcripts for several genes expressed at early stages of lymphocyte and myeloid/erythroid cell development. The clones were able to generate lymphoid, myeloid, and erythroid hematopoietic cells and to reconstitute the hematopoietic system of irradiated mice for a long time. The availability of lymphohematopoietic stem cell lines should facilitate the analysis of the molecular mechanisms that control self-renewal and differentiation and the development of efficient protocols for somatic gene therapy.

Normal human serum contains a natural IgM antibody cytotoxic for human neuroblastoma cells.

Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.

Identification of a unique membrane-bound molecule on a hemopoietic stem cell line and on multipotent progenitor cells.

Hemopoietic stem cells are a distinct population of cells that can differentiate into multilineages of hemopoietic cells and have long-term repopulation capability. A few membrane-bound molecules have been found to be preferentially, but not uniquely, present on the surface of these primitive cells. We report here the identification of a unique 105-kDa glycoprotein on the surface of hemopoietic stem cell line BL3. This molecule, recognized by the absorbed antiserum, is not present on the surface of myeloid progenitors 32D and FDC-P1 cells, EL4 T cells, and NIH 3T3 fibroblasts. This antiserum can also be used to block the proliferation of BL3 cells even in the presence of mitogen-stimulated spleen cell conditioned medium, which is known to have a stimulating activity on BL3 cells. It can also inhibit development of in vitro, fetal liver cell-derived multilineage colonies, but not other types of colonies, and of in vivo bone marrow cell-derived colony-forming unit spleen foci. These data suggest that gp105 plays an important role in hemopoietic stem cell differentiation.

The killing of Leishmania major by human macrophages is mediated by nitric oxide induced after ligation of the Fc epsilon RII/CD23 surface antigen.

Serum IgE concentrations and the expression of the low-affinity receptor for IgE (Fc epsilon RII/CD23) are increased in cutaneous leishmaniasis or after immune challenge with Leishmania antigens. In vitro, the ligation of CD23 by IgE-anti-IgE immune complexes (IgE-IC) or by anti-CD23 monoclonal antibody (mAb) induces nitric oxide (NO) synthase and the generation of various cytokines by human monocytes/macrophages. The present study shows that IgE-IC, via CD23 binding, induce intracellular killing of Leishmania major in human monocyte-derived macrophages through the induction of the L-arginine:NO pathway. This was demonstrated by increased generation of nitrite (NO2-), the stable oxidation product of NO, and by the ability of NG-monomethyl-L-arginine to block both NO generation and parasite killing. A similar NO-dependent effect was observed with interferon gamma-treated cells. Tumor necrosis factor alpha is involved in this process, since both the induction of NO synthase and the killing of parasites caused by anti-CD23 mAb were inhibited by an anti-tumor necrosis factor alpha mAb. Treatment of noninfected CD23+ macrophages with IgE-IC provided protection against subsequent in vitro infection of these cells by Leishmania major promastigotes. Thus, IgE-IC promote killing of L. major by inducing NO synthase in human macrophages.

Long-term repopulation of hematolymphoid cells with only a few hemopoietic stem cells in mice.

A PCR-based assay has been devised for the detection and semiquantitation of cells originating from a few donor hematopoietic stem cells (HSCs) in a background of recipient cells. Upon sequencing a segment of murine Y chromosome contained in the plasmid pY2, oligonucleotide primers were designed for specific amplification of the Y chromosome-restricted segment. The HSCs were isolated from the bone marrow of mice on day 4 following a single i.v. injection of 5-fluorouracil and were readily distinguished from other bone marrow elements by the characteristics of low density, absence of lineage-specific surface markers, lack of expression of transferrin receptor, and a high expression of major histocompatibility complex class I antigen. Injection of as few as four such HSCs was shown to produce donor-derived cells (including lymphoid cells) for at least 8 months after transplantation into syngeneic female recipients. Retransplantation, employing 10(6) bone marrow cells from the initial recipients, also yielded clear evidence of repopulation with detectable levels of male donor cells. On statistical grounds, it is clear that long-term repopulation in vivo may result from even a single HSC having the characteristics defined herein.

Isolation of a differentially regulated splicing isoform of human NF-E2.

The transcription factor NF-E2 (nuclear factor erythroid 2), interacting via DNA motifs within regulatory regions of several hematopoietic genes, is thought to mediate the enhancer activity of the globin locus control regions. By screening a human fetal liver cDNA library with probes derived from mouse NF-E2, we have isolated a splicing variant of the NF-E2 gene (fNF-E2) that differs in the 5' untranslated region from the previously reported cDNA (aNF-E2). The fNF-E2 isoform is transcribed from an alternative promoter located in the 3' end of the first intron and joined by alternative splicing to the second and third exons, which are shared by both RNA isoforms. Although the two forms produce the same protein, they are expressed in different ratios during development. fNF-E2 is more abundant in the fetal liver and less abundant in the adult bone marrow compared to the previously described form. Their distribution apparently follows the differential expression of fetal and adult hemoglobins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.