Basal body-associated DNA: in situ studies in Chlamydomonas reinhardtii.

We have explored the localization of the uni chromosome (LG XIX) of Chlamydomonas reinhardtii using the technique of in situ hybridization. Using standardized methods of cell fixation together with large chromosome-specific probes we have studied the position of uni DNA sequences in metaphase and interphase cells. We find that in dividing cells uni probes identify a condensed metaphase chromosome that shows no specialized orientation. In interphase cells uni hybridization signals occur on the anterior edge of the nucleus at a position where basal bodies are normally associated with the nuclear envelope. These data reveal an underlying spatial organization of uni chromosomal DNA within the interphase nucleus that may be significant in terms of the fact that this chromosome encodes numerous functions affecting basal body and flagellar assembly.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Raluca L. Radulescu and Cory James Rushton, eds. 2009: A Companion to Medieval Popular Romance. Studies in Medieval Romance 10. Cambridge: D. S. Brewer. XIV + 209 pp. ISBN 9781843841920

This review is part of a research project funded by the Spanish Ministry of Science and Innovation (ref. FFI 2008-02165).

Tulane studies in zoology and botany.

v.28 (1991-1992)

Tulane studies in zoology and botany.

v.20 (1978)

Tulane studies in zoology and botany.

v.29 (1993-1994)

Tulane studies in zoology.

v.6 (1958)

Tulane studies in zoology and botany.

v.30 (1995-1996)

Tulane studies in zoology and botany.

v.21 (1979)

Tulane studies in zoology.

v.7 (1959)

Tulane studies in zoology and botany.

v.19 (1975-1977)

Tulane studies in zoology and botany.

v.17 (1971-1972)