981 resultados para 2,3 bis(2 methoxy 4 nitro 5 sulfophenyl) 5 ((phenylamino)carbonyl) 2H tetrazolium hydroxide


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A bi-weekly newsletter for those involved in the fields of homeland security and/or emergency management

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This bimonthly electronic newsletter will provide information and resources on nutrition and health promotion and disease prevention. The Healthy Aging Update is produced for informal and educational purposes only. The newsletter will be distributed electronically and posted on the Department’s website at www.state.ia.us/elderaffairs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

El patrón de sucesión a largo plazo en los bosques subalpinos de Pinus uncinata y su relación con el régimen de perturbaciones al que se ven sometidos se analizan aquí, tomando como referencia el modelo de sucesión de PEET & CHRISTENSEN (1987). Por métodos dendrocronológicos, utilizando datos de árboles vivos y muertos, se han reconstruido los últimos 140-220 años de la historia de tres bosques suficientemente viejos y poco alterados, al menos recientemente, por el hombre. Los resultados ponen de manifiesto ciertas regularidades importantes en la secuencia y en la duración de las fases de la sucesión observadas en la escala espacial que nos permite el muestreo realizado (un transecto lineal de 280-350 metros. De una larga fase de iniciación (110140 años) se pasa casi directamente a una fase de transición, con escasa evidencia de una fase intermedia de exclusión. Este patrón de sucesión, causado por la lentitud y la heterogeneidad espacial de la fase de iniciación y por un régimen de pequeñas perturbaciones dispersas y frecuentes que aparecen muy pronto, es similar al observado en otros bosques subalpinos y ambientes extremos y representa una desviación respecto del modelo de referencia. La tasa media de mortalidad natural de los áboles adultos durante las últimas 4-6 décadas ha sido, respectivamente para los tres bosques, de 6,2, 1,4 y 5,7% por década. Estas tasas son lo sufientemente bajas como para permitir una larga persistencia en la fase de transición de la cohorte dominante - la instalada durante la fase de iniciación -, en declive pero al mismo tiempo inhibiendo la aparición masiva de regeneración. Ello hace previsible una dinámica de la estructura y la funcionalidad del bosque muy fluctuante a largo plazo en la escala espacial estudiada, aunque en su origen puede encontrarse la mano del hombre a través de una perturbación inicial homogeneizadora

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Acacia mearnsii de Wild (black wattle) is one of the most important trees planted in Southern Brazil for tannin extraction and charcoal production. The pyrolysis of the black wattle wood used for obtaining charcoal is performed in brick ovens, with the gas fraction being sent directly into the environment. The present study examines the condensable compounds present in the liquor produced from black wattle wood at different thermal degradation conditions, using gas chromatography coupled with mass spectrometry (GC/MS). Branches of black wattle were thermally degraded at controlled ambient and temperature conditions. Overall, a higher variety of compounds were obtained under atmospheric air pressure than under synthetic air pressure. Most of the tentatively identified compounds, such as carboxylic acids, phenols, aldehydes, and low molecular mass lignin fragments, such as guayacol, syringol, and eugenol, were products of lignin thermoconversion. Substituted aromatic compounds, such as vanillin, ethyl vanillin, and 2-methoxy-4-propeny-phenol, were also identified. At temperatures above 200 ºC, furan, 2-acetylfuran, methyl-2-furoate, and furfural, amongst others, were identified as polysaccharide derivatives from cellulose and hemicellulose depolymerization. This study evidences the need for adequate management of the condensable by-products of charcoal production, both for economic reasons and for controlling their potential environmental impact.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pemphigus foliaceus (PF) is characterized by acantholysis determined by IgG4 binding to desmoglein I, a 160-kDa desmosomal glycoprotein. To investigate the immunopathological aspects of Brazilian PF, we determined levels of serum cytokines in patients with PF. Twenty-five patients with PF and a control group consisting of 10 healthy individuals were studied. Serum IL-2, IL-4, IL-5, IL-10, IL-12 and IFN-gamma were measured in the two groups by ELISA. The median concentration of IL-2 was lower in PF patients compared to the control group (0.45 and 9.50 pg/ml, respectively), as also was the concentration of IL-4 (0.26 and 10.16 pg/ml, respectively). The same was observed for IL-5 (7.94 and 15.74 pg/ml, respectively) and for IFN-gamma (5.90 and 8.58 pg/ml, respectively). For IL-10 and IL-12, higher concentrations were observed in PF compared to the control group (IL-10: 24.76 and 20.92; IL-12: 2.92 and 1.17 pg/ml, respectively). Considering the Th1/Th2 paradigm, it seems that a Th2 profile, mainly represented by IL-10, predominates in PF.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ancien possesseur : Argenson, Antoine-René de Voyer (1722-1787 ; marquis de Paulmy d')

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Survey map of the Second Welland Canal created by the Welland Canal Company showing the Town of St. Catharines. Identified structures associated with the Canal include Lock 4, Lock House, Lock 5, Small Lock House, the towing path, and Gasometer for Canal. The surveyors' measurements and notes can be seen in red and black ink and pencil. Local area landmarks are also identified and include streets and roads (ex. Geneva Street, Queenston Street, and Academy Street), C. Phelps Mill and Store House, St. Catharines and Welland Canal Gas Works, William Mahony's Tannery, Cooper Shop, a barrel shed, barn, and gas tanks. Properties and property owners of note are: Concession 6 Lots 14, 14, and 16, Concession 7 Lots 14, 15, and 16, C. Phelps, R. M. Clement, Orson Phelps, R. Collier, D. P. Haynes, W. Chace, and John Soper.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pour toute demande de reproduction de contenu se trouvant dans cette publication, communiquer avec l’Association des diplômés de l’UdeM.