An Intergenic Regulatory Region Mediates Drosophila Myc -Induced Apoptosis and Blocks Tissue Hyperplasia

Induction of cell-autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However, the detailed mechanism mediating this process remains enigmatic. In this study, we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (irradiation-responsive enhancer region). The IRER mediates the expression of surrounding proapoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In a previous work, we showed that the IRER also mediates P53-dependent induction of proapoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53- and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress.

Parasite-mediated nuclear factor kappaB regulation in lymphoproliferation caused by Theileria parva infection.

Infection of cattle with the protozoan Theileria parva results in uncontrolled T lymphocyte proliferation resulting in lesions resembling multicentric lymphoma. Parasitized cells exhibit autocrine growth characterized by persistent translocation of the transcriptional regulatory factor nuclear factor kappaB (NFkappaB) to the nucleus and consequent enhanced expression of interleukin 2 and the interleukin 2 receptor. How T. parva induces persistent NFkappaB activation, required for T cell activation and proliferation, is unknown. We hypothesized that the parasite induces degradation of the IkappaB molecules which normally sequester NFkappaB in the cytoplasm and that continuous degradation requires viable parasites. Using T. parva-infected T cells, we showed that the parasite mediates continuous phosphorylation and proteolysis of IkappaBalpha. However, IkappaBalpha reaccumulated to high levels in parasitized cells, which indicated that T. parva did not alter the normal NFkappaB-mediated positive feedback loop which restores cytoplasmic IkappaBalpha. In contrast, T. parva mediated continuous degradation of IkappaBbeta resulting in persistently low cytoplasmic IkappaBbeta levels. Normal IkappaBbeta levels were only restored following T. parva killing, indicating that viable parasites are required for IkappaBbeta degradation. Treatment of T. parva-infected cells with pyrrolidine dithiocarbamate, a metal chelator, blocked both IkappaB degradation and consequent enhanced expression of NFkappaB dependent genes. However treatment using the antioxidant N-acetylcysteine had no effect on either IkappaB levels or NFkappaB activation, indicating that the parasite subverts the normal IkappaB regulatory pathway downstream of the requirement for reactive oxygen intermediates. Identification of the critical points regulated by T. parva may provide new approaches for disease control as well as increase our understanding of normal T cell function.

STUDIES ON THE CLASS I GLYCOPROTEINS OF THE MURINE MAJOR HISTOCOMPATIBILITY COMPLEX (TRANSPLANTATION ANTIGEN, LYMPHOCYTE, CELL SURFACE MOLECULE)

A series of studies were undertaken to analyze and compare various aspects of murine class I glycoproteins. An initial area of investigation characterized the Qa-1 alloantigens using two-dimensional gel electrophoresis. Analysis of the products of the Qa-1('b), Qa-1('c) and Qa-1('d) alleles indicated that these were distinct molecules as determined by their lack of comigration upon comparative two-dimensional gel analysis. The importance of asparagine-linked glycosylation in the cell surface expression of class I molecules was also examined. These studies employed tunicamycin, an inhibitor of N-linked glycosylation. Tunicamycin treatment of activated T lymphocytes diminished the surface expression of Qa-1 to undetectable levels; the levels of other class I molecules exhibited little or no decrease. These results indicated that N-linked glycosylation has a differential importance in the cell surface expression of various class I molecules. The molecular weight diversity of class I molecules was also investigated. Molecular weight determination of both the fully glycosylated and unglycosylated forms of H-2 and Qa/Tla region encoded molecules established that there is a significant variation in the sizes of these forms of various class I molecules. The most significant difference ((TURN)9,000 daltons) exists between the unglycosylated forms of H-2K('b) and Qa-2, suggesting that the structural organization of these two molecules may be very different. A comparative two-dimensional gel analysis of various class I glycoproteins isolated from resting and activated T and B lymphocytes indicated that class I molecules expressed on activated T cells exhibited an isoelectrophoretic pattern that was distinct from the isoelectrophoretic pattern of class I molecules expessed on the other cell populations. This difference was attributed to a lower sialic acid content of the molecules expressed on activated T cells. Analysis of cell homogenates determined that activated T cells contained a higher level of endogenous neuraminidase activity than was detected in the other populations, suggesting that this may be the basis of the lower sialic acid content. The relationship of the Qa-4 and Qa-2 alloantigens was also examined. It was established that upon mitogen activation, the expression of Qa-4 was greatly decreased, whereas Qa-2 expression was not decreased. However, an anti-Qa-2 monoclonal antibody blocked the binding of an anti-Qa-4 monoclonal antibody to resting cells. These studies established that Qa-4 is a determinant restricted to resting cells, which is closely associated on the surface with the Qa-2 molecule. ^

Glucocorticoid alterations in the human type-1/type-2 cytokine balance and the role of CD28/B7 costimulation

We have recently reported that psychological stress is associated with a shift in the human type-1/type-2 cytokine balance toward a type-2 cytokine response. The mechanisms of these cytokine alterations are unknown, but likely involve glucocorticoid (GC) modulation of cytokine production. Therefore we sought to characterize the effects of GC on the in vitro human type-1/type-2 cytokine balance. We hypothesized that GC induce a type-2 cytokine shift through modulation of critical regulatory cytokines and alterations in the CD28/B7 costimulatory pathway. ^ We first sought to characterize the effect of the GC, dexamethasone (DEX), on type-1 (IFN-γ, IL-12) and type-2 (IL-4, IL-10) cytokine production by human peripheral blood mononuclear blood cells (pBMC) stimulated with a variety of T-lymphocyte and monocyte stimuli. DEX, at concentrations mimicking stress and supraphysiologic levels of cortisol, decreased IFN-γ and IL-12 production and increased IL-4 and IL-10 production, indicating a shift in the type-1/type-2 cytokine balance toward a type-2 response. Furthermore, both CD4+ and CD8+ T-lymphocytes were susceptible to the cytokine modulating effects of DEX. Furthermore, in the absence of the monocyte, the DEX-induced alterations in T-lymphocyte cytokine production were reduced, indicating that the interaction between the monocyte and T-lymphocyte plays a significant role. ^ We next determined the role of regulatory cytokines, known to modulate the type-1/type-2 cytokine balance, in the DEX-induced cytokine alterations. The addition of the recombinant IL-12p70 and IFN-γ, but not the neutralization of IL-4, IL-10 or IL-13 using monoclonal antibodies, attenuated the DEX-induced type-1/type-2 cytokine alterations. These data suggest that the DEX-induced cytokine alterations are mediated, at least in part, through the initial inhibition type-1 cytokines. Lastly, we investigated the role of the CD28/B7 costimulatory pathway in these cytokine alterations. DEX decreased the expression of CD80 and CD86 on THP-1 cells, a monocyte cell line, and the expression of CD28 and CTLA-4 on PHA-stimulated pBMC. The DEX-induced decrease in CD28 and CTLA-4 expression was attenuated by rhIL-12. Finally, CD28 activation attenuated the DEX-induced decrease in IFN-γ production, suggesting that modulation of the CD28/B7 costimulatory pathway may contribute to the DEX-induced type-1/type-2 cytokine alterations. ^

Molecular regulatory mechanisms and embryonic tissue specification in sea urchin development

To understand how a eukaryote achieves differential transcription of genes in precise spatial patterns, the molecular details of tissue specific expression of the Strongylocentrotus purpuratus Spec2a gene were investigated by functional studies of the cis-regulatory components in the upstream enhancer. Regional activation of Spec2a in the aboral ectoderm is conferred by a combination of activators and repressors. The positive regulators include previously identified SpOtx and a trans-regulatory factor binding at the CCAAT site in the Spec2a enhancer. The nuclear protein binding to the CCAAT box was determined to be the heterotrimeric CCAAT binding factor (SpCBF). SpCBF also mediates general activation in the ectoderm. The negative regulators consist of an oral ectoderm repressor (OER), an endoderm repressor (ENR), and an S. Purpuratus goosecoid homologue (SpGsc). OER functions to prevent expression in the oral ectoderm, while ENR is required to repress endoderm expression. SpGsc antagonizes the SpOtx function by competing for binding at SpOtx target genes in oral ectoderm, where it functions as an active repressor. Thus, SpOtx and SpGsc perform collectively to establish and maintain the oral-aboral axis. Finally, purification of ENR and OER proteins from sea urchin blastula stage nuclear extracts was performed using site-specific DNA-affmity chromatography. ^

17-beta estradiol and progesterone-induced alterations in human type-1/type-2 cytokine balance and the role of costimulatory and apoptotic mechanisms

Evidence suggests that sex-based differences in immune function may predispose women to numerous hypersensitivity conditions such as Systemic lupus erythematosus (SLE), Hashimoto's thyroiditis and asthma. To date, the exact mechanisms of sexual dimorphism in immunity are not fully characterized but sex hormones such as 17-β estradiol (E2) and progesterone (PR) are believed to be involved. Since E2 and PR may modulate the production of critical regulatory cytokines, we sought to characterize their effects on the in vitro human type-1/type-2 cytokine balance. We hypothesized that E2 and/or PR vary cytokine production and influence costimulatory molecule expression and apoptosis. We first described the effect of E2 and/or PR on type-1 (IFN-γ and IL-12) and type-2 (IL-4 and IL-10) cytokine production by human peripheral blood mononuclear cells (PBMC) treated with various T-lymphocyte and monocyte stimuli. E2 and/or PR were each used at concentrations similar to those found at the maternal-fetal interface during pregnancy. At this dose, E2 increased IFN-γ and IL-12 production and PR decreased IFN-γ production and tended to increase IL-4 production. Furthermore, the combination of E2+PR decreased IL-12 production. This suggests that E2 shifts the type-1/type-2 cytokine balance towards a type-1 response and that PR and E2+PR shift the balance towards a type-2 response. Next, we used intracellular cytokine detection to demonstrate that E2 and/or PR are capable of altering cytokine production of CD3+ T-cells and the CD3+CD4+ and CD3+CD8+ subsets. In addition, we used the H9 T-lymphocyte cell line and the THP-1 monocyte cell line to show that E2 and/or PR can induce cytokine effects in both T-cells and monocytes independent of their interaction. Lastly, we determined the effect of E2 and/or PR on costimulatory molecule expression and apoptosis as potential mechanisms for the cytokine-induced alterations. E2 increased and PR decreased CD80 expression on THP-1 cells and PR and E2+PR decreased CD28 expression in PBMC and Jurkat cells. Furthermore, E2, PR and E2+PR increased Fas-mediated apoptosis in Jurkat cells and E2 increased FasL expression on THP-1 cells. Thus, E2 and/or PR may alter the cytokine balance by modulating the CD28/CD80 costimulatory pathway and apoptosis. ^

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Characterization of tumor-associated Foxp3+ regulatory T cells and de-novo induction by the tumor microenvironment

Regulatory T cells expressing the fork-head box transcription factor 3 (Foxp3) play a central role in the dominant control of immunological tolerance. Compelling evidence obtained from both animal and clinical studies have now linked the expansion and accumulation of Foxp3+ regulatory T cells associated with tumor lesions to the failure of immune-mediated tumor rejection. However, further progress of the field is hampered by the gap of knowledge regarding their phenotypic, functional, and the developmental origins in which these tumor-associated Foxp3+ regulatory T cells are derived. Here, we have characterized the general properties of tumor-associated Foxp3+ regulatory T cells and addressed the issue of tumor microenvironment mediated de-novo induction by utilizing a well known murine tumor model MCA-205 in combination with our BAC Foxp3-GFP reporter mice and OT-II TCR transgenic mice on the RAG deficient background (RAG OT-II). De-novo induction defines a distinct mechanism of converting non-regulatory precursor cells to Foxp3+ regulatory T cells in the periphery as opposed to the expansion of pre-existing regulatory T cells formed naturally during thymic T cell development. This mechanism is of particularly importance to how tumors induce tumor-antigen-specific suppressor cells to subvert anti-tumor immune responses. Our study has found that tumor-associated Foxp3+ regulatory T cells are highly activated, undergo vigorous proliferation, are more potent by in-vitro suppression assays, and express higher levels of membrane-bound TGF-β1 than non-tumor regulatory T cells. With Foxp3-GFP reporter mice or RAG OT-II TCR transgenic mice, we show that tumor tissue can induce detectable de-novo generation of Foxp3+ regulatory T cells of both polyclonal or antigen specific naïve T cells. This process was not only limited for subcutaneous tumors but for lung tumors as well. Furthermore, this process required the inducing antigen to be co-localized within the tumor tissue. Examination of tumor tissue revealed an abundance of myeloid CD11b+ antigen-presenting cells that were capable of inducing Foxp3+ regulatory T cells. Taken together, these findings elucidate the general attributes and origins of tumor-associated Foxp3+ regulatory T cells in the tumor microenvironment and in their role in the negative regulation of tumor immunity.^

From protein microarray to biology: The discovery of epigenetic regulatory molecules

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

The association between CD4+ lymphocyte count and measures of body composition in HIV-infected men

Purpose. This project was designed to describe the association between wasting and CD4 cell counts in HIV-infected men in order to better understand the role of wasting in progression of HIV infection.^ Methods. Baseline and prevalence data were collected from a cross-sectional survey of 278 HIV-infected men seen at the Houston Veterans Affairs Medical Center Special Medicine Clinic, from June 1, 1991 to January 1, 1994. A follow-up study was conducted among those at risk, to investigate the incidence of wasting and the association between wasting and low CD4 cell counts. Wasting was described by four methods. Z-scores for age-, sex-, and height-adjusted weight; sex-, and age-adjusted mid-arm muscle circumference (MAMC); and fat-free mass; and the ratio of extra-cellular mass (ECM) to body-cell mass (BCM) $>$ 1.20. FFM, ECM, and BCM were estimated from bioelectrical impedance analysis. MAMC was calculated from triceps skinfold and mid-arm circumference. The relationship between wasting and covariates was examined with logistic regression in the cross-sectional study, and with Poisson regression in the follow-up study. The association between death and wasting was examined with Cox's regression.^ Results. The prevalence of wasting ranged from 5% (weight and ECM:BCM) to almost 14% (MAMC and FFM) among the 278 men examined. The odds of wasting, associated with baseline CD4 cell count $<$200, was significant for each method but weight, and ranged from 4.6 to 12.7. Use of antiviral therapy was significantly protective of MAMC, FFM and ECM:BCM (OR $\approx$ 0.2), whereas the need for antibacterial therapy was a risk (OR 3.1, 95% CI 1.1-8.7). The average incidence of wasting ranged from 4 to 16 per 100 person-years among the approximately 145 men followed for 160 person-years. Low CD4 cell count seemed to increase the risk of wasting, but statistical significance was not reached. The effect of the small sample size on the power to detect a significant association should be considered. Wasting, by MAMC and FFM, was significantly associated with death, after adjusting for baseline serum albumin concentration and CD4 cell count.^ Conclusions. Wasting by MAMC and FFM were strongly associated with baseline CD4 cell counts in both the prevalence and incidence study and strong predictors of death. Of the two methods, MAMC is convenient, has available reference population data, may be the most appropriate for assessing the nutritional status of HIV-infected men. ^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Role of janus tyrosine kinase -3 (JAK3) and signal transducer and activator of transcription (STAT5) pathway in T lymphocyte activation

T cell activation and expansion is essential for immune response against foreign antigens. However, uncontrolled T cell activity can be manifested as a number of lymphoid derived diseases such as autoimmunity, graft versus host disease, and lymphoma. The purpose of this research was to test the central hypothesis that the Jak3/Stat5 pathway is critical for T cell function. To accomplish this objective, two novel Jak3 inhibitors, AG490 and PNU156804, were identified and their effects characterized on Jak3/Stat5 activation and T cell growth. Inhibition of Jak3 selectively disrupted primary human T lymphocyte growth in response to Interleukin-2 (IL-2), as well as other γ c cytokine family members including IL-4, IL-7, IL-9, and IL-15. Inhibition of Jak3 ablated IL-2 induced Stat5 but not TNF-α mediated NF-κβ DNA binding. Loss of Jak3 activity did not affect T cell receptor mediated signals including activation of p56Lck and Zap70, or IL-2 receptor a chain expression. To examine the effects of Jak3/Stat5 inhibition within a mature immune system, we employed a rat heart allograft model of Lewis (RT1 1) to ACI (RT1a). Heart allograft survival was significantly prolonged following Jak3/Stat5 inhibition when rats were treated with AG490 (20mg/kg) or PNU156804 (80mg/kg) compared to non-treated control animals. This effect was synergistically potentiated when Jak3 inhibitors were used in combination with a signal 1/2 disrupter, cyclosporine, but only additively potentiated with another signal 3 inhibitor, rapamycin. This suggested that sequential inhibition of T cell function is more effective. To specifically address the role of Stat5 in maintaining T cell activity, novel Stat5 antisense oligonucleotides were synthesized and characterized in vitro. Primary human T cells and T-cell tumor lines treated with Stat5 antisense oligonucleotide (7.5 μM) rapidly underwent apoptosis, while no changes in cell cycle were observed as measured by FACS analysis utilizing Annexin-V-Fluorescein and Propidium iodide staining. Evidence is provided to suggest that caspase 8 and 9 pathways mediate this event. Thus, Stat5 may act rather as a negative regulator of apoptotic signals and not as a positive regulator of cell cycle as previously proposed. We conclude that the Jak3/Stat5 pathway is critical for γc cytokine mediated gene expression necessary for T cell expansion and normal immune function and represents an therapeutically relevant effector pathway to combat T cell derived disease. ^