Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

On the relationship between performance-approach goals and cognitive performance : when the desire to outperform others becomes interfering

Cette thèse explore dans quelle mesure la poursuite d'un but de performance-approche (i.e., le désir de surpasser autrui et de démontrer ses compétences) favorise, ou au contraire endommage, la réussite et l'apprentissage-une question toujours largement débattue dans la littérature. Quatre études menées en laboratoire ont confirmé cette hypothèse et démontré que la poursuite du but de performance-approche amène les individus à diviser leur attention entre d'une part la réalisation de la tâche évaluée, et d'autre part la gestion de préoccupations liées à l'atteinte du but-ceci empêchant une concentration efficace sur les processus de résolution de la tâche. Dans une deuxième ligne de recherche, nous avons ensuite démontré que cette distraction est exacerbée chez les individus les plus performants et ayant le plus l'habitude de réussir, ceci dérivant d'une pression supplémentaire liée au souhait de maintenir le statut positif de « bon élève ». Enfin, notre troisième ligne de recherche a cherché à réconcilier ces résultats-pointant l'aspect distractif du but de performance-approche-avec le profil se dégageant des études longitudinales rapportées dans la littérature-associant ce but avec la réussite académique. Ainsi, nous avons mené une étude longitudinale testant si l'adoption du but de performance-approche en classe pourrait augmenter la mise en oeuvre de stratégies d'étude tactiquement dirigées vers la performance-favorisant une réussite optimale aux tests. Nos résultats ont apporté des éléments en faveur de cette hypothèse, mais uniquement chez les élèves de bas niveau. Ainsi, l'ensemble de nos résultats permet de mettre en lumière les processus cognitifs à l'oeuvre lors de la poursuite du but de performance-approche, ainsi que d'alimenter le débat concernant leur aspect bénéfique ou nuisible en contexte éducatif. -- In this dissertation, we propose to investigate whether the pursuit of performance-approach goals (i.e., the desire to outperform others and appear talented) facilitates or rather endangers achievement and learning-an issue that is still widely discussed in the achievement goal literature. Four experiments carried out in a laboratory setting have provided evidence that performance- approach goals create a divided-attention situation that leads cognitive resources to be divided between task processing and the activation of goal-attainment concerns-which jeopardizes full cognitive immersion in the task. Then, in a second research line, we found evidence that high- achievers (i.e., those individuals who are the most used to succeed) experience, under evaluative contexts, heightened pressure to excel at the task, deriving from concerns associated with the preservation of their "high-achiever" status. Finally, a third research line was designed to try to reconcile results stemming from our laboratory studies with the overall profile emerging from longitudinal research-which have consistently found performance-approach goals to be a positive predictor of students' test scores. We thus set up a longitudinal study so as to test whether students' adoption of performance-approach goals in a long-term classroom setting enhances the implementation of strategic study behaviors tactically directed toward goal-attainment, hence favoring test performance. Our findings brought support for this hypothesis, but only for low-achieving students. Taken together, our findings shed new light on the cognitive processes at play during the pursuit of performance-approach goals, and are likely to fuel the debate regarding whether performance-approach goals should be encouraged or not in educational settings.

Melanin-based coloration in juvenile kestrels (Falco tinnunculus) covaries with anti-predatory personality traits

Recent studies have shown that melanin-based coloration is associated with the ability to cope with stressful environments, potentially explaining why coloration covaries with anti-predator behaviours, boldness and docility. To investigate whether these relationships are consistent across species, we performed a study in the European kestrel (Falco tinnunculus). Similar to our results found previously in the barn owl (Tyto alba), nestling kestrels displaying a larger sub-terminal black tail band stayed on their back longer (tonic immobility test) and breathed at a lower rate than individuals with a smaller black band when handled. However, in contrast to barn owls, nestling kestrels with a larger black tail band were more aggressive and more agitated. Our results strengthen the hypothesis that melanin coloration is related to stress response and in turn to the reaction to predators, a very important personality trait (i.e. boldness).

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Développement d'un Test Sérologique Contre le Virus de la Chorioméningite Lymphocytaire

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).

The QUASAR reproducibility study, Part II: Results from a multi-center Arterial Spin Labeling test-retest study.

Arterial Spin Labeling (ASL) is a method to measure perfusion using magnetically labeled blood water as an endogenous tracer. Being fully non-invasive, this technique is attractive for longitudinal studies of cerebral blood flow in healthy and diseased individuals, or as a surrogate marker of metabolism. So far, ASL has been restricted mostly to specialist centers due to a generally low SNR of the method and potential issues with user-dependent analysis needed to obtain quantitative measurement of cerebral blood flow (CBF). Here, we evaluated a particular implementation of ASL (called Quantitative STAR labeling of Arterial Regions or QUASAR), a method providing user independent quantification of CBF in a large test-retest study across sites from around the world, dubbed "The QUASAR reproducibility study". Altogether, 28 sites located in Asia, Europe and North America participated and a total of 284 healthy volunteers were scanned. Minimal operator dependence was assured by using an automatic planning tool and its accuracy and potential usefulness in multi-center trials was evaluated as well. Accurate repositioning between sessions was achieved with the automatic planning tool showing mean displacements of 1.87+/-0.95 mm and rotations of 1.56+/-0.66 degrees . Mean gray matter CBF was 47.4+/-7.5 [ml/100 g/min] with a between-subject standard variation SD(b)=5.5 [ml/100 g/min] and a within-subject standard deviation SD(w)=4.7 [ml/100 g/min]. The corresponding repeatability was 13.0 [ml/100 g/min] and was found to be within the range of previous studies.

Concrete Pavement Mixture Design and Analysis (MDA): Development and Evaluation of Vibrating Kelly Ball Test (VKelly Test) for the Workability of Concrete, 2015

Due to the low workability of slipform concrete mixtures, the science of rheology is not strictly applicable for such concrete. However, the concept of rheological behavior may still be considered useful. A novel workability test method (Vibrating Kelly Ball or VKelly test) that would quantitatively assess the responsiveness of a dry concrete mixture to vibration, as is desired of a mixture suitable for slipform paving, was developed and evaluated. The objectives of this test method are for it to be cost-effective, portable, and repeatable while reporting the suitability of a mixture for use in slipform paving. The work to evaluate and refine the test was conducted in three phases: 1. Assess whether the VKelly test can signal variations in laboratory mixtures with a range of materials and proportions 2. Run the VKelly test in the field at a number of construction sites 3. Validate the VKelly test results using the Box Test developed at Oklahoma State University for slipform paving concrete The data collected to date indicate that the VKelly test appears to be suitable for assessing a mixture’s response to vibration (workability) with a low multiple operator variability. A unique parameter, VKelly Index, is introduced and defined that seems to indicate that a mixture is suitable for slipform paving when it falls in the range of 0.8 to 1.2 in./√s.