992 resultados para Site na internet, pesquisa
Resumo:
Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
A study was carried out to evaluate the feasibility of autologous adipose derived stem cells (ADSC) transplantation into female rabbits` urethra walls as an alternative to intrinsic urethral regeneration. Inguinal fat pad of 12 New Zealand adult female rabbits were harvested and processed to obtain stromal vascular fraction (SVF). The SVF were platted to isolate ADSC. Before urethral injection, cells were labeled with DiI marker. The urethra wall was injected with 1 x 10(7) autologous cells or saline (sham). The urethra was harvested at 2, 4, and 8 weeks to identify DiI-labeled cells. At 2 and 4 weeks, the ADSCs create a nodule localized in the urethral sub-mucosa. At 8 weeks, the ADSCs spread and integrated with the urethra wall from the initial injection site. This is the first study to demonstrate a successful autologous ADSCs transplantation. It confirms that ADSCs can survive and integrate within the urethral wall.
Resumo:
Objectives: The aim of this study was to determine whether the addition of the measurement of bilateral hip bone mineral density (BMD) has an impact on indications for osteoporosis (OP) treatment in community-dwelling elderly individuals, based on criteria from the National Osteoporosis Foundation (NOF). Methods: In total, 605 consecutive community-dwelling elderly individuals who were 65 years and older were evaluated. Dual energy X-ray absorptiometry was used to determine the lowest T-score in the lumbar spine + unilateral hip, the bilateral hips, and the lumbar spine + bilateral hips. Risk factors associated with the lowest T-score in these three conditions were applied to indicate treatment in accordance with NOF criteria. McNemar`s test was used to assess the difference of adding bilateral hip BMD measurements. Results: There was a significant difference in the frequency of pharmacological indication using NOF criteria together with the lowest T-score for the three tests (72.8% for lumbar spine + bilateral hips and 71.2% for lumbar spine + unilateral hip; p=0.002). A higher frequency of treatment indication was also observed for lumbar spine + unilateral hip (71.2%) compared to bilateral hips (61.1%) (p<0.001). The discrepancies in treatment appeared to be more evident in women when analyzed by gender distribution. Conclusion: Our finding supports the theory that evaluation of the bilateral hips with the lumbar spine seems to be more sensitive measure for identifying patients with an osteoporosis treatment indication. Furthermore, despite the well-known artifact in the lumbar spine, this site should not be excluded when determining the indication for OP treatment in elderly people. (C) 2009 Elsevier Ireland Ltd. All rights reserved.
Resumo:
Lima GA, Anhe GF, Giannocco G, Nunes MT, Correa-Giannella ML, Machado UF. Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors. Am J Physiol Endocrinol Metab 296: E132-E138, 2009. First published October 28, 2008; doi: 10.1152/ajpendo.90548.2008.-Skeletal muscle is a target tissue for approaches that can improve insulin sensitivity in insulin-resistant states. In muscles, glucose uptake is performed by the GLUT-4 protein, which is encoded by the SLC2A4 gene. SLC2A4 gene expression increases in response to conditions that improve insulin sensitivity, including chronic exercise. However, since chronic exercise improves insulin sensitivity, the increased SLC2A4 gene expression could not be clearly attributed to the muscle contractile activity per se and/or to the improved insulin sensitivity. The present study was designed to investigate the role of contractile activity per se in the regulation of SLC2A4 gene expression as well as in the participation of the transcriptional factors myocyte enhancer factor 2D (MEF2D), hypoxia inducible factor 1a (HIF-1a), and thyroid hormone receptor-alpha (TR alpha). The performed in vitro protocol excluded the interference of metabolic, hormonal, and neural effects. The results showed that, in response to 10 min of electrically induced contraction of soleus muscle, an early 40% increase in GLUT-4 mRNA (30 min) occurred, with a subsequent 65% increase (120 min) in GLUT-4 protein content. EMSA and supershift assays revealed that the stimulus rapidly increased the binding activity of MEF2D, HIF-1a, and TR alpha into the SLC2A4 gene promoter. Furthermore, chromatin immunoprecipitation assay confirmed, in native nucleosome, that contraction induced an approximate fourfold (P < 0.01) increase in MEF2D and HIF-1a-binding activity. In conclusion, muscle contraction per se enhances SLC2A4 gene expression and that involves MEF2D, HIF-1a, and TR alpha transcription factor activation. This finding reinforces the importance of physical activity to improve glycemic homeostasis independently of other additional insulin sensitizer approaches.
Resumo:
DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.
Resumo:
Hepatitis B virus (HBV) infection is a significant public health concern with 350 million chronic carriers worldwide. Eight HBV genotypes (A-H) have been described so far. Genotype E (HBV/E) is widely distributed in West Africa and has rarely been found in other continents, except for a few cases in individuals with an African background. In this study, we characterized HBV genotypes in Quibdo, Colombia, by partial S/P gene sequencing, and found, for the first time, HBV/E circulating in nine Afro-Colombian patients who had no recent contact with Africa. The presence of HBV/E in this community as a monophyletic group suggests that it was a result of a recent introduction by some Afro-descendent contact or, alternatively, that the virus came with slaves brought to Colombia. By using sequences with sampling dates, we estimated the substitution rate to be about 3.2x10(-4) substitutions per site per year, which resulted in a time to the most recent common ancestor (TMRCA) of 29 years. In parallel, we also estimated the TMRCA for HBV/E by using two previously estimated substitution rates (7.7x10(-4) and 1.5x10(-5) substitutions per site per year). The TMRCA was around 35 years under the higher rate and 1500 years under the slower rate. In sum, this work reports for the first time the presence of an exclusively African HBV genotype circulating in South America. We also discuss the time of the entry of this virus into America based on different substitution rates estimated for HBV.
Resumo:
Hepatitis delta virus (HDV) is widely distributed and associated with fulminant hepatitis epidemics in areas with high prevalence of HBV. Several studies performed in the 1980s showed data on HDV infection in South America, but there are no studies on the viral dynamics of this virus. The aim of this study was to conduct an evolutionary analysis of hepatitis delta genotype 3 (HDV/3) prevalent in South America: estimate its nucleotide substitution rate, determine the time of most recent ancestor (TMRCA) and characterize the epidemic history and evolutionary dynamics. Furthermore, we characterized the presence of HBV/HDV infection in seven samples collected from patients who died due to fulminant hepatitis from Amazon region in Colombia and included them in the evolutionary analysis. This is the first study reporting HBV and HDV sequences from the Amazon region of Colombia. Of the seven Colombian patients, five were positive for HBV-DNA and HDV-RNA. Of them, two samples were successfully sequenced for HBV (subgenotypes F3 and Fib) and the five samples HDV positive were classified as HDV/3. By using all HDV/3 available reference sequences with sampling dates (n = 36), we estimated the HDV/3 substitution rate in 1.07 x 10(-3) substitutions per site per year (s/s/y), which resulted in a time to the most recent common ancestor (TMRCA) of 85 years. Also, it was determined that HDV/3 spread exponentially from early 1950s to the 1970s in South America. This work discusses for the first time the viral dynamics for the HDV/3 circulating in South America. We suggest that the measures implemented to control HBV transmission resulted in the control of HDV/3 spreading in South America, especially after the important raise in this infection associated with a huge mortality during the 1950s up to the 1970s. The differences found among HDV/3 and the other HDV genotypes concerning its diversity raises the hypothesis of a different origin and/or a different transmission route. (C) 2011 Elsevier B.V. All rights reserved.
Resumo:
Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.
Resumo:
BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.
Resumo:
Methods We pooled data from 17 case-control studies including 12 716 cases and the 17 438 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were estimated for associations between body mass index (BMI) at different ages and HNC risk, adjusted for age, sex, centre, race, education, tobacco smoking and alcohol consumption. Results Adjusted ORs (95% CIs) were elevated for people with BMI at reference (date of diagnosis for cases and date of selection for controls) < 18.5 kg/m(2) (2.13, 1.75-2.58) and reduced for BMI > 25.0-30.0 kg/m(2) (0.52, 0.44-0.60) and BMI >= 30 kg/m(2) (0.43, 0.33-0.57), compared with BMI > 18.5-25.0 kg/m(2). These associations did not differ by age, sex, tumour site or control source. Although the increased risk among people with BMI < 18.5 kg/m(2) was not modified by tobacco smoking or alcohol drinking, the inverse association for people with BMI > 25 kg/m(2) was present only in smokers and drinkers. Conclusions In our large pooled analysis, leanness was associated with increased HNC risk regardless of smoking and drinking status, although reverse causality cannot be excluded. The reduced risk among overweight or obese people may indicate body size is a modifier of the risk associated with smoking and drinking. Further clarification may be provided by analyses of prospective cohort and mechanistic studies.
Resumo:
Leishmaniasis is a parasitic disease caused by the intramacrophage protozoa Leishmania spp. and may be fatal if left untreated. Although pentavalent antimonials are toxic and their mechanism of action is unclear, they remain the first-line drugs for treatment of leishmaniasis. An effective therapy could be achieved by delivering antileishmanial drugs to the site of infection. Compared with free drugs, antileishmanial agent-containing liposomes are more effective, less toxic and have fewer adverse side effects. The aim of this study was to develop novel meglumine antimoniate (MA)-containing liposome formulations and to analyse their antileishmanial activity and uptake by macrophages. Determination of the 50% inhibitory concentration (IC(50)) values showed that MA-containing liposomes were >= 10-fold more effective than the free drug, with a 5-fold increase in selectivity index, higher activity and reduced macrophage toxicity. The concentration required to kill 100% of intracellular amastigotes was >= 40-fold lower when MA was encapsulated in liposomes containing phosphatidylserine compared with the free drug. Fluorescence microscopy analysis revealed increased uptake of fluorescent liposomes in infected macrophages after short incubation times compared with non-infected macrophages. In conclusion, these data suggest that MA encapsulated in liposome formulations is more effective against Leishmania-infected macrophages than the non-liposomal drug. Development of liposome formulations is a valuable approach to the treatment of infectious diseases involving the mononuclear phagocyte system. (C) 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Resumo:
Since the first description of Leishmania (Viannia) shawi, few studies were performed with this parasite. In the present work, the in vivo and ex vivo behavior of L. (Viannia) shawi infection was studied using murine model. Peritoneal macrophages from BALB/c and C57BL/6 mice were infected with promastigotes in the stationary phase of growth; after 24 h, the infection index and nitric oxide (NO) levels in the supernatant of the cultures were analyzed. BALB/c and C57BL/6 mice were infected into the hind footpad, and at each 2 weeks, mice were sacrificed, and the histological changes of the skin inoculation site, parasitism, and humoral immune responses were evaluated during 8 weeks. Ex vivo experiments showed that macrophages of BALB/c presented higher infection index and lesser NO levels than macrophages of C57BL/6. In vivo experiments showed that BALB/c presented higher lesion size than C57BL/6 mice; similarly, the histopathological changes and the parasitism in skin were more exacerbate in BALB/c mice. In draining lymph nodes, the main change was increase of germinative centers, and parasites were detected from 6 weeks pi onwards in both mice strain. IgG was detected in BALB/c mice from 4 weeks, while in C57BL/6, from 6 weeks pi onwards. Taken together, these results indicate that BALB/c showed a classical behavior of susceptibility when compared to C57BL/6 mice.