910 resultados para SEQUENCES


Relevância:

20.00% 20.00%

Publicador:

Resumo:

By using taxonomic characters derived from EcoRI restriction endonuclease digestion of genomic DNA and hybridization with a labeled rRNA operon from Escherichia coli, a polymorphic structure of Listeria monocytogenes, characterized by fragments with different frequencies of occurrence, was observed. This structure was expanded by creating predicted patterns through a recursive process of observation, expectation, prediction, and assessment of completeness. This process was applied, in turn, to normalized strain patterns, fragment bands, and positions of EcoRI recognition sites relative to rRNA regions. Analysis of 1346 strains provided observed patterns, fragment sizes, and their frequencies of occurrence in the patterns. Fragment size statistics led to the creation of unobserved combinations of bands, predicted pattern types. The observed fragment bands revealed positions of EcoRI sites relative to rRNA sequences. Each EcoRI site had a frequency of occurrence, and unobserved fragment sizes were postulated on the basis of knowing the restriction site locations. The result of the recursion process applied to the components of the strain data was an extended classification with observed and predicted members.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Abstract. Speckle is being used as a characterization tool for the analysis of the dynamics of slow-varying phenomena occurring in biological and industrial samples at the surface or near-surface regions. The retrieved data take the form of a sequence of speckle images. These images contain information about the inner dynamics of the biological or physical process taking place in the sample. Principal component analysis (PCA) is able to split the original data set into a collection of classes. These classes are related to processes showing different dynamics. In addition, statistical descriptors of speckle images are used to retrieve information on the characteristics of the sample. These statistical descriptors can be calculated in almost real time and provide a fast monitoring of the sample. On the other hand, PCA requires a longer computation time, but the results contain more information related to spatial–temporal patterns associated to the process under analysis. This contribution merges both descriptions and uses PCA as a preprocessing tool to obtain a collection of filtered images, where statistical descriptors are evaluated on each of them. The method applies to slow-varying biological and industrial processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Comunicación presentada en el VII Symposium Nacional de Reconocimiento de Formas y Análisis de Imágenes, SNRFAI, Barcelona, abril 1997.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Deformable Template models are first applied to track the inner wall of coronary arteries in intravascular ultrasound sequences, mainly in the assistance to angioplasty surgery. A circular template is used for initializing an elliptical deformable model to track wall deformation when inflating a balloon placed at the tip of the catheter. We define a new energy function for driving the behavior of the template and we test its robustness both in real and synthetic images. Finally we introduce a framework for learning and recognizing spatio-temporal geometric constraints based on Principal Component Analysis (eigenconstraints).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper introduces a novel MILP approach for the design of distillation columns sequences of zeotropic mixtures that explicitly include from conventional to fully thermally coupled sequences and divided wall columns with a single wall. The model is based on the use of two superstructure levels. In the upper level a superstructure that includes all the basic sequences of separation tasks is postulated. The lower level is an extended tree that explicitly includes different thermal states and compositions of the feed to a given separation task. In that way, it is possible to a priori optimize all the possible separation tasks involved in the superstructure. A set of logical relationships relates the feasible sequences with the optimized tasks in the extended tree resulting in a MILP to select the optimal sequence. The performance of the model in terms of robustness and computational time is illustrated with several examples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A sequential design method is presented for the design of thermally coupled distillation sequences. The algorithm starts by selecting a set of sequences in the space of basic configurations in which the internal structure of condensers and reboilers is explicitly taken into account and extended with the possibility of including divided wall columns (DWC). This first stage is based on separation tasks (except by the DWCs) and therefore it does not provide an actual sequence of columns. In the second stage the best arrangement in N-1 actual columns is performed taking into account operability and mechanical constraints. Finally, for a set of candidate sequences the algorithm try to reduce the number of total columns by considering Kaibel columns, elimination of transfer blocks or columns with vertical partitions. An example illustrate the different steps of the sequential algorithm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human behaviour recognition has been, and still remains, a challenging problem that involves different areas of computational intelligence. The automated understanding of people activities from video sequences is an open research topic in which the computer vision and pattern recognition areas have made big efforts. In this paper, the problem is studied from a prediction point of view. We propose a novel method able to early detect behaviour using a small portion of the input, in addition to the capabilities of it to predict behaviour from new inputs. Specifically, we propose a predictive method based on a simple representation of trajectories of a person in the scene which allows a high level understanding of the global human behaviour. The representation of the trajectory is used as a descriptor of the activity of the individual. The descriptors are used as a cue of a classification stage for pattern recognition purposes. Classifiers are trained using the trajectory representation of the complete sequence. However, partial sequences are processed to evaluate the early prediction capabilities having a specific observation time of the scene. The experiments have been carried out using the three different dataset of the CAVIAR database taken into account the behaviour of an individual. Additionally, different classic classifiers have been used for experimentation in order to evaluate the robustness of the proposal. Results confirm the high accuracy of the proposal on the early recognition of people behaviours.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During infections, Giardia lamblia undergoes a continuous change of its major surface antigens, the variant-specific surface proteins (VSPs). Many studies on antigenic variation have been performed using G. lamblia clone GS/M-83-H7, which expresses surface antigen VSP H7. The present study was focused on the identification and characterization of vsp gene sequences within the genome of the clonal G. lamblia GS/M-83-H7 line. For this purpose, we applied a PCR which specifically amplified truncated sequences from the 3'-terminal region of the vsp genes. Upon cloning, most of the vsp gene amplification products were shown to be approximately identical in size and thus could not be distinguished from each other by conventional gel electrophoresis. In order to pre-estimate the sequence complexity within the large panel of vsp clones isolated, we elaborated a novel concept which facilitated our large-scale genetic screening approach: PCR products from cloned DNA molecules were generated and then subjected to a DNA melting profile assay based on the use of the LightCycler Instrument. This high-throughput assay system proved to be well suited to monitor sequence differences between the amplification products from closely related vsp genes and thus could be used for the primary, sequence-related discrimination of the corresponding clones. After testing 50 candidates, vsp clones could be divided into five groups, each characterized by an individual DNA melting profile of the corresponding amplification products. Sequence analysis of some of these 50 candidates confirmed data from the aforementioned assay in that clones were demonstrated to be identical within, but different between, the distinct groups. The nucleotide and deduced amino acid sequences of five representative vsp clones showed high similarities both among each other and also with the corresponding gene segment of the variant-specific surface antigen (VSP H7) expressed by the original GS/M-83-H7 variant type. Furthermore, three of the genomic vsp sequences turned out to be identical to vsp sequences that represented previously characterized transcription products from in vivo- or in vitro-switched GS/M-83-H7 trophozoites. In conclusion, the DNA melting profile assay seems to be a versatile tool for the PCR-based genotyping of moderately or highly diversified sequence orthologues.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Targeting hard-to-reach/marginalized populations is essential for preventing HIV-transmission. A unique opportunity to identify such populations in Switzerland is provided by a database of all genotypic-resistance-tests from Switzerland, including both sequences from the Swiss HIV Cohort Study (SHCS) and non-cohort sequences. A phylogenetic tree was built using 11,127 SHCS and 2,875 Swiss non-SHCS sequences. Demographics were imputed for non-SHCS patients using a phylogenetic proximity approach. Factors associated with non-cohort outbreaks were determined using logistic regression. Non-B subtype (univariable odds-ratio (OR): 1.9; 95% confidence interval (CI): 1.8-2.1), female gender (OR: 1.6; 95% CI: 1.4-1.7), black ethnicity (OR: 1.9; 95% CI: 1.7-2.1) and heterosexual transmission group (OR:1.8; 95% CI: 1.6-2.0), were all associated with underrepresentation in the SHCS. We found 344 purely non-SHCS transmission clusters, however, these outbreaks were small (median 2, maximum 7 patients) with a strong overlap with the SHCS'. 65% of non-SHCS sequences were part of clusters composed of >= 50% SHCS sequences. Our data suggests that marginalized-populations are underrepresented in the SHCS. However, the limited size of outbreaks among non-SHCS patients in-care implies that no major HIV outbreak in Switzerland was missed by the SHCS surveillance. This study demonstrates the potential of sequence data to assess and extend the scope of infectious-disease surveillance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The utility of the HMBC experiment for structure elucidation is unquestionable, but the nature of the coupling pathways leading to correlations in an HMBC experiment creates the potential for misinterpretation. This misinterpretation potential is intimately linked to the size of the long-range heteronuclear couplings involved, and may become troublesome in those cases of a particularly strong 2JCH correlation that might be mistaken for a 3JCH correlation or a 4JCH correlation of appreciable strength that could be mistaken for a weaker 3JCH correlation. To address these potential avenues of confusion, work from several laboratories has been focused on the development of what might be considered “coupling pathway edited” long-range heteronuclear correlation experiments that are derived from or related to the HMBC experiment. The first example of an effort to address the problems associated with correlation path length was seen in the heteronucleus-detected XCORFE experiment described by Reynolds and co-workers that predated the development of the HMBC experiment. Proton-detected analogs of the HMBC experiment intended to differentiate 2JCH correlations from nJCH correlations where n = 3, 4, include the 2J,3J-HMBC, HMBC-RELAY, H2BC, edited-HMBC, and HAT H2BC experiments. The principles underlying the critical components of each of these experiments are discussed and experimental verification of the results that can be obtained using model compounds are shown. This contribution concludes with a brief discussion of the 1,1-ADEQUATE experiments that provide an alternative means of identifying adjacent protonated and non-protonated carbon correlations by exploiting 1JCC correlations at natural abundance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

At two locations in the Atlantic Ocean (DSDP Sites 367 and 530) early to middle Cretaceous organic-carbon-rich beds (black shales) were found to have significantly lower delta15N values (lower 15N/14N ratios) than adjacent organic-carbon-poor beds (white limestones or green claystones). While these lithologies are of marine origin, the black strata in particular have delta15N values that are significantly lower than those previously found in the marine sediment record and most contemporary marine nitrogen pools. In contrast, black, organic-carbon-rich beds at a third site (DSDP Site 603) contain predominantly terrestrial organic matter and have C- and N-isotopic compositions similar to organic matter of modern terrestrial origin. The recurring 15N depletion in the marine-derived Cretaceous sequences prove that the nitrogen they contain is the end result of an episodic and atypical biogeochemistry. Existing isotopic and other data indicate that the low 15N relative abundance is the consequence of pelagic rather than post-depositional processes. Reduced ocean circulation, increased denitrification, and, hence, reduced euphoric zone nitrate availability may have led to Cretaceous phytoplankton assemblages that were periodically dominated by N2-fixing blue-green algae, a possible source of this sediment 15N-depletion. Lack of parallel isotopic shifts in Cretaceous terrestrially-derived nitrogen (Site 603) argues that the above change in nitrogen cycling during this period did not extend beyond the marine environment.