1000 resultados para Metodologia de Cuidar humanitude


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Relevância:

20.00% 20.00%

Publicador:

Resumo:

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cancer goes on to be a frightening disease by humanity, simetimes,it is considered as death, suffering and stigma synonym. Occurring at childhood, this meaning seems to acquire a more intense conotation, having in view of the perplexity and godliness feeling in the presence of the precocity of events, nearly always associated to the death. A psychologist co-existence with the cancer children is going acquiring, thus, a permeated sense by incognitas , fears and fantasy, which raised us the following question: how does the psychologist that answers children with cancer lives this experience? Therefore, the aim this research was to understand this co-existence experience. Our theoretical perspective comes from an existencial fenomenology and, more specifically, the Humanistic Approach and Martin Heidegger Existencial Ontology. The metodology is qualitative of phenomenological character. The access instrument to the experience was the narrative, such as purpose by Walter Benjamin. They were carried out nine semi-open interviews with psychologists who work on pediatric oncology services of Natal-RN city. Such interviews were recorded in cassette, transcripted and later, re-educated. These interviews were recorded, transcribed and later on edited with the help of the interviewee and turned into a text. The narrative comprehension was carried out on Heidegger Existencial Ontology, on dada exaustive reading and the clipping of indicative passages of experience sense of being psychologist on this area. The research suggests that the experience is oriented of clinic kowing-doing, being crossed by implications of key thematics which indicate the care as central ontologic element that orientates the way as these professionals come being in the world in association with the clientèle. Besides, the caring experience of these children acquire the sense of true living experience, since the cancer undoes the immortality illusion, launching the psychologist to his/her condition of being to the death and with that, calling him/her the authenticity. Is is only not dealt with to experience the anguish and the death imminence, but above all, re-meaning them in favour of a continual learning, of quality answering , besides other possibilities. Working with child cancer brings news perspectives and world views, making the psychologist a more human people and sensitive to the distracted needs. And we believe that, regardless of area which actuates, being psychologist is a particular way which choose to be citizen. Is is a project that will be delimited by society, history and culture and after all, by us like human being. Therefore, we understand that the results this research suggest the discussed thematic deepening on this intervention field in order to new sense possibilities can arise giving origin to other reflections about the clinical practice, the professional formation in Psychology and other possible developments

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The study of sediment in water bodies presents great environmental importance, because of its ability to adsorb the pollutants, they may facilitate the understanding of the history of the current quality of the water system. Depending on how it is done the collection, analysis can show both a recent contamination as old. The detailed characterization of the sediment may reveal details that can understand how each type of pollutant interacts with the material given its composition. In this work it has developed a systematic methodology to characterize samples of sediment, with the aim to understand how a series of metal is distributed in different size fractions of the sediment. This study was conducted in five samples of sediment (P1, P2, P3a, P3B and P3c) collected in Jundiaí river, one of the most important tributaries of the river Potengi in the region of Macaíba, RN. The characterization was made with the samples previously sieved into meshes with different granulometries (+8#, -8+16#, -16+65# - 65+100#,-100+200#,-200+250# and -250#), using the following techniques: Analysis of specific surface area by BET method, determining the levels of organic matter (OM%) and humidity through the gravimetry and Analysis Thermogravimetric (TG), Infrared Spectroscopy in a Fourier transform (FTIR ), Analysis of X ray diffraction (XRD), analysis of heavy metals by optical emission spectrometry with the Argon Plasma (ICP-OES). The analyzed elements were Al, Cd, Cr, Cu, Fe, Mn, Ni, Zn and P. In addition to the techniques of characterization above, was also made the rebuilding of the samples P1, P2 and P3B in relation to the levels of organic matter and concentration of heavy metals. Then, the results of the recomposed samples were compared with those obtained in crude samples, showing great consistency. The gravimetry, used in determining the levels of organic matter, was not considered an appropriate method because the clay minerals present in the sediment samples analyzed fall apart in the same range of temperature (550-600 0C) used in roasting (600 0C). The results also showed the trend of organic matter and heavy metals to focus on the thin fractions, although the largest concentrations of metals are in intermediate fractions

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aiming of this work is linked to chemical education, focusing organic chemistry classes of Chemical Engineering, Pharmacy and Zootechny graduate courses of the Federal University of Rio Grande do Norte. For that, teaching-learning process related to basic chemical subjects which support the understanding of organic chemistry concepts was evaluated in a research period of two years. The education proposal linked to the theoretical content of the cited classes, pointed out the process of knowledge construction, in which educational commitment as well as dedication in the teaching-learning process was also valued. In that approach several didactic tools were applied, among them scientific articles were used as supplementary studies of the basic organic chemistry concepts and related. The acceptability of students, as well as their motivation, performance and learning process was justified by the data collection of the applied teaching methodology. The acceptability and commitment of the students facing this teaching interactive approach, which transversely contributed to the intellectual maturity growth of the students, as well their professional development, were evidenced by satisfactory obtained results that will be herein discussed

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, we worked with the validation of a methodology for analysis of bioactive amines in shrimp, considering it to be one of the main products of the northriograndense trade balance, maintaining the state of Rio Grande do Norte topped the list of Brazilian exports of this product the last decade. The sector of the Brazilian shrimp works exclusively with gray shrimp Litopenaeus Vannamei since the late 1990s. This study used liquid chromatography with conductimetric detector, using as the mobile phase methylsulfonic 3 mM acid (MSA) with gradient and phase C18 column with reverse the development of methodology for the analysis of bioactive amines in shrimp. In the sample preparation was used as 5% trichloroacetic acid (TCA) extraction solution. Validation analysis of biotativas amines (putrescine - PUT, histamine - HIST, agmatine - AGM, spermidine - EPD and spermine - EPN) in shrimp, the linear working range was 0.1 to 2.0 mg L-1 to was sensitive, homoscedastic, in effect, selective, accurate and precise array. Thus, considered feasible for these determinations bioactive amines in this array. Determined the concentration of these amines in fresh shrimps (AGM = 0.61 ± 0.05 mg kg- 1 EPD = 2.57 ± 0.14 mg kg-1 and EPN = 1.79 ± 0.11 mg kg-1), and freezing weather predetermined in cooked shrimp (AGM = 6.28 ± 0.18 mg kg-1, EPD = 12.72 ± 0.02 mg kg- 1 and EPN = 22.30 ± 0.60 mg kg-1), the shrimp with twenty-four hour stay at room temperature (PUT = 879.52 ± 28.12 mg kg-1, AGM = 848.13 ± 19.40 mg kg-1, ESPD = 13.59 ± 0.97 mg kg-1 and ESPN = 18.47 + 1.57 mg kg-1). In shrimp subjected to freezing for a week, two weeks, three weeks and four weeks, the results showed that there is an increase in the content of agmatine (7.31 ± 0.21 mg kg-1) while in spermine ( 1.22 ± 0.14 mg kg-1) and spermidine (below limit of quantification) there was a decrease in the freeze time, while there is a decrease in the level of spermidine not reaching detectad. The putrescine was only found in shrimp that remained for 24 hours at room temperature and histamine was not found in any of the samples

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foi desenvolvido um método para detectar e quantificar misturas de corantes em sucos artificiais em pó fabricados no Brasil, de diferentes marcas e sabores. Foram estudados 6 corantes artificiais: amarelo tartrazina, amarelo crepúsculo, vermelho ponceau 4R, vermelho bordeaux S, vermelho 40 e azul brilhante presentes de forma unitária ou em misturas nos sucos com sabores laranja, tangerina, maracujá, abacaxi, limão e uva. A identificação dos corantes nas amostras foi feita através da comparação com os espectros dos padrões, utilizando-se a análise por infravermelho médio e pelos respectivos valores de absorção máxima nos comprimentos de onda relativos aos padrões e valores de referência na literatura. Também foram estudados os perfis de decomposição térmica por termogravimetria, termogravimetria derivada e calorimetria diferencial exploratória dos corantes e dos sucos em pó, sendo determinados os teores de umidade, de matéria orgânica e de cinzas. O teor de umidade encontrado não ultrapassou 4% para todas as amostras de suco analisadas. Com relação ao teor de matéria orgânica obteve-se para 57% dos sucos analisados um teor médio de 51,3% e para 43% das outras amostras obteve-se uma média de 67,2 %. Os resultados obtidos para o teor de cinzas indicaram que 29% das amostras apresentaram um teor de 26,7% para esse parâmetro enquanto 71% das amostras apresentaram um teor de cinzas de 46,4%. Os resultados obtidos por análise térmica mostraram-se adequados considerando-se que para obter os resultados pelo método tradicional há um investimento maior de tempo, de pessoal envolvido e de material, além da proteção ao meio ambiente. Para a análise por espectroscopia de absorção molecular foi proposta uma equação simplificada para a determinação de cada corante na mistura utilizando-se a lei de Beer. Para validação, empregou-se a espectroscopia de absorção molecular no visível, onde foi investigada a influência dos interferentes (TiO2 e açúcar) presentes nas amostras de sucos, os testes de fotodegradação e a avaliação do efeito do pH. Para quantificação tomou-se como referência 512 amostras sintéticas contendo um e dois corantes (1,5625 a 25,000 mg L-1) para obtenção das curvas analíticas que foram aplicadas à análise dos sucos em pó. Os resultados indicaram que o teor máximo do amarelo crepúsculo foi encontrado nos sucos com os sabores laranja, tangerina e manga que correspondeu a 25,6% da ingestão diária aceitável (para ser ultrapassada corresponderia a ingestão de 4 copos). O teor máximo encontrado para o amarelo tartrazina nos sucos foi para o sabor maracujá que correspondeu a 8,5% da ingestão diária aceitável, (para ser alcançado corresponderia a ingestão de 12 copos). O método proposto foi testado e validado com sucesso para amostras de sucos em pó sendo de simples execução e de rapidez na obtenção dos resultados

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hylocereus undatus (Haw.), popularmente conhecida como pitaia vermelha é uma cactácea para a qual se tem registrado um aumento de consumo nos últimos anos e, por ser ainda pouco explorada, vários aspectos referentes à sua propagação ainda são desconhecidos. Até o momento, não existem critérios para a execução de testes de germinação para sementes dessa espécie, publicados nas Regras para Análise de Sementes. Nesse sentido, objetivou-se com este trabalho adequar a metodologia quanto ao substrato, temperatura e tempo de contagem inicial e final para o teste de germinação. Foram testados quatro substratos (rolo de papel, areia, vermiculita e solo) e quatro temperaturas (20, 25, 30 e 20-30°C). O efeito dos substratos no desempenho germinativo das sementes foi avaliado pelo teste de germinação e de primeira contagem instalado com quatro subamostras de 50 sementes. Foram feitas contagens diárias do número de plântulas emergidas até atingirem a estabilidade e, no final do experimento, foram avaliados a porcentagem de germinação das sementes, considerando as plântulas normais, anormais e sementes mortas. Concluiu-se que o teste de germinação de sementes de pitaia vermelha deve ser realizado à temperatura constante de 25°C em rolo de papel, com contagens inicial e final aos cinco e dez dias após a semeadura, respectivamente.