Expression of endogenous peptide-major histocompatibility complex class II complexes derived from invariant chain-antigen fusion proteins.

CD4+ T cells recognize major histocompatibility complex (MHC) class II-bound peptides that are primarily obtained from extracellular sources. Endogenously synthesized proteins that readily enter the MHC class I presentation pathway are generally excluded from the MHC class II presentation pathway. We show here that endogenously synthesized ovalbumin or hen egg lysozyme can be efficiently presented as peptide-MHC class II complexes when they are expressed as fusion proteins with the invariant chain (Ii). Similar to the wild-type Ii, the Ii-antigen fusion proteins were associated intracellularly with MHC molecules. Most efficient expression of endogenous peptide-MHC complex was obtained with fusion proteins that contained the endosomal targeting signal within the N-terminal cytoplasmic Ii residues but did not require the luminal residues of Ii that are known to bind MHC molecules. These results suggest that signals within the Ii can allow endogenously synthesized proteins to efficiently enter the MHC class II presentation pathway. They also suggest a strategy for identifying unknown antigens presented by MHC class II molecules.

Multimeric complexes of the PML-retinoic acid receptor alpha fusion protein in acute promyelocytic leukemia cells and interference with retinoid and peroxisome-proliferator signaling pathways.

The t(15;17) chromosomal translocation, specific for acute promyelocytic leukemia (APL), fuses the PML gene to the retinoic acid receptor alpha (RAR alpha) gene, resulting in expression of a PML-RAR alpha hybrid protein. In this report, we analyzed the nature of PML-RAR alpha-containing complexes in nuclear protein extracts of t(15;17)-positive cells. We show that endogenous PML-RAR alpha can bind to DNA as a homodimer, in contrast to RAR alpha that requires the retinoid X receptor (RXR) dimerization partner. In addition, these cells contain oligomeric complexes of PML-RAR alpha and endogenous RXR. Treatment with retinoic acid results in a decrease of PML-RAR alpha protein levels and, as a consequence, of DNA binding by the different complexes. Using responsive elements from various hormone signaling pathways, we show that PML-RAR alpha homodimers have altered DNA-binding characteristics when compared to RAR alpha-RXR alpha heterodimers. In transfected Drosophila SL-3 cells that are devoid of endogenous retinoid receptors PML-RAR alpha inhibits transactivation by RAR alpha-RXR alpha heterodimers in a dominant fashion. In addition, we show that both normal retinoid receptors and the PML-RAR alpha hybrid bind and activate the peroxisome proliferator-activated receptor responsive element from the Acyl-CoA oxidase gene, indicating that retinoids and peroxisome proliferator receptors may share common target genes. These properties of PML-RAR alpha may contribute to the transformed phenotype of APL cells.

Probing the transmembrane topology of cyclic nucleotide-gated ion channels with a gene fusion approach.

Cyclic nucleotide-gated (CNG) cation channels contain two short sequence motifs--a residual voltage-sensor (S4) and a pore-forming (P) segment--that are reminiscent of similar segments in voltage-activated Shaker-type K+ channels. It has been tacitly assumed that CNG channels and this K+ channel subfamily share a common overall topology, characterized by a hydrophobic domain comprising six membrane-spanning segments. We have systematically investigated the topology of CNG channels from bovine rod photoreceptor and Drosophila melanogaster by a gene fusion approach using the bacterial reporter enzymes alkaline phosphatase and beta-galactosidase, which are active only in the periplasm and only in the cytoplasm, respectively. Enzymatic activity was determined after expression of fusion constructs in Escherichia coli. CNG channels were found to have six membrane-spanning segments, suggesting that CNG and Shaker-type K+ channels, albeit distant relatives within a gene superfamily of ion channels, share a common topology.

Persistent infection of rhesus macaques with T-cell-line-tropic and macrophage-tropic clones of simian/human immunodeficiency viruses (SHIV).

To elucidate the functions of human immunodeficiency virus type 1 (HIV-1) genes in a nonhuman primate model, we have constructed infectious recombinant viruses (chimeras) between the pathogenic molecular clone of simian immunodeficiency virus (SIV) SIVmac239 and molecular clones of HIV-1 that differ in phenotypic properties controlled by the env gene. HIV-1SF33 is a T-cell-line-tropic virus which induces syncytia, and HIV-1SF162 is a macrophage-tropic virus that does not induce syncytia. A DNA fragment encoding tat, rev, and env (gp160) of SIVmac239 has been replaced with the counterpart genetic region of HIV-1SF33 and HIV-1SF162 to derive chimeric recombinant simian/human immunodeficiency virus (SHIV) strains SHIVSF33 and SHIVSF162, respectively. In the acute infection stage, macaques inoculated with SHIVSF33 had levels of viremia similar to macaques infected with SIVmac239, whereas virus loads were 1/10th to 1/100th those in macaques infected with SHIVSF162. Of note is the relatively small amount of virus detected in lymph nodes of SHIVSF162-infected macaques. In the chronic infection stage, macaques infected with SHIVSF33 also showed higher virus loads than macaques infected with SHIVSF162. Virus persists for over 1 year, as demonstrated by PCR for amplification of viral DNA in all animals and by virus isolation in some animals. Antiviral antibodies, including antibodies to the HIV-1 env glycoprotein (gp160), were detected; titers of antiviral antibodies were higher in macaques infected with SHIVSF33 than in macaques infected with SHIVSF162. Although virus has persisted for over 1 year after inoculation, these animals have remained healthy with no signs of immunodeficiency. These findings demonstrate the utility of the SHIV/macaque model for analyzing HIV-1 env gene functions and for evaluating vaccines based on HIV-1 env antigens.

Identification of a second homolog of N-ethylmaleimide-sensitive fusion protein that is expressed in the nervous system and secretory tissues of Drosophila.

N-Ethylmaleimide-sensitive fusion protein (NSF) is an ATPase known to have an essential role in intracellular membrane transport events. Recently, cDNA clones encoding a Drosophila melanogaster homolog of this protein, named dNSF, were characterized and found to be expressed in the nervous system. We now report the identification of a second homolog of NSF, called dNSF-2 within this species and report evidence that this ubiquitous and widely utilized fusion protein belongs to a multigene family. The predicted amino acid sequence of dNSF-2 is 84.5% identical to dNSF (hereafter named dNSF-1), 59% identical to NSF from Chinese hamster, and 38.5% identical to the yeast homolog SEC18. The highest similarity was found in a region of dNSF-2 containing one of two ATP-binding sites; this region is most similar to members of a superfamily of ATPases. dNSF-2 is localized to a region between bands 87F12 and 88A3 on chromosome 3, and in situ hybridization techniques revealed expression in the nervous system during embryogenesis and in several imaginal discs and secretory structures in the larvae. Developmental modulation of dNSF-2 expression suggests that quantitative changes in the secretory apparatus are important in histogenesis.

Anti-melanoma antibodies from melanoma patients immunized with genetically modified autologous tumor cells: selection of specific antibodies from single-chain Fv fusion phage libraries.

Fusion phage libraries expressing single-chain Fv antibodies were constructed from the peripheral blood lymphocytes of two melanoma patients who had been immunized with autologous melanoma cells transduced the gamma-interferon gene to enhance immunogenicity, in a trial conducted at another institution. Anti-melanoma antibodies were selected from each library by panning the phage against live cultures of the autologous tumor. After two or three rounds of panning, clones of the phage were tested by ELISA for binding to the autologous tumor cells; > 90% of the clones tested showed a strong ELISA reaction, demonstrating the effectiveness of the panning procedure for selecting antimelanoma antibodies. The panned phage population was extensively absorbed against normal melanocytes to enrich for antibodies that react with melanoma cells but not with melanocytes. The unabsorbed phage were cloned, and the specificities of the expressed antibodies were individually tested by ELISA with a panel of cultured human cells. The first tests were done with normal endothelial and fibroblast cells to identify antibodies that do not react, or react weakly, with two normal cell types, indicating some degree of specificity for melanoma cells. The proportion of phage clones expressing such antibodies was approximately 1%. Those phage were further tested by ELISA with melanocytes, several melanoma lines, and eight other tumor lines, including a glioma line derived from glial cells that share a common lineage with melanocytes. The ELISA tests identified three classes of anti-melanoma antibodies, as follows: (i) a melanoma-specific class that reacts almost exclusively with the melanoma lines; (ii) a tumor-specific class that reacts with melanoma and other tumor lines but does not react with the normal melanocyte, endothelial and fibroblast cells; and (iii) a lineage-specific class that reacts with the melanoma lines, melanocytes, and the glioma line but does not react with the other lines. These are rare classes from the immunized patients' repertoires of anti-melanoma antibodies, most of which are relatively nonspecific anti-self antibodies. The melanoma-specific class was isolated from one patient, and the lineage-specific class was isolated from the other patient, indicating that different patients can have markedly different responses to the same immunization protocol. The procedures described here can be used to screen the antibody repertoire of any person with cancer, providing access to an enormous untapped pool of human monoclonal anti-tumor antibodies with clinical and research potential.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Identification of a plastid protein involved in vesicle fusion and/or membrane protein translocation.

Structural evidence has accumulated suggesting that fusion and/or translocation factors are involved in plastid membrane biogenesis. To test this hypothesis, we have developed an in vitro system in which the extent of fusion and/or translocation is monitored by the conversion of the xanthophyll epoxide (antheraxanthin) into the red ketocarotenoid (capsanthin). Only chromoplast membrane vesicles from red pepper fruits (Capsicum annuum) contain the required enzyme. Vesicles prepared from the mutant yellow cultivar are devoid of this enzyme and accumulate antheraxanthin. The fusion and/or translocation activity is characterized by complementation due to the synthesis of capsanthin and the parallel decrease of antheraxanthin when the two types of vesicles are incubated together in the presence of plastid stroma. We show that the extent of conversion is dependent upon an ATP-requiring protein that is sensitive to N-ethylmaleimide. Further purification and immunological analysis have revealed that the active factor, designated plastid fusion and/or translocation factor (Pftf), resides in a protein of 72 kDa. cDNA cloning revealed that mature Pftf has significant homology to yeast and animal (NSF) or bacterial (Ftsh) proteins involved in vesicle fusion or membrane protein translocation.

Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.

Chromosomal rearrangements involving band 12p13 are found in a wide variety of human leukemias but are particularly common in childhood acute lymphoblastic leukemia. The genes involved in these rearrangements, however, have not been identified. We now report the cloning of a t(12;21) translocation breakpoint involving 12p13 and 21q22 in two cases of childhood pre-B acute lymphoblastic leukemia, in which t(12;21) rearrangements were not initially apparent. The consequence of the translocation is fusion of the helix-loop-helix domain of TEL, an ETS-like putative transcription factor, to the DNA-binding and transactivation domains of the transcription factor AML1. These data show that TEL, previously shown to be fused to the platelet-derived growth factor receptor beta in chronic myelomonocytic leukemia, can be implicated in the pathogenesis of leukemia through its fusion to either a receptor tyrosine kinase or a transcription factor. The TEL-AML1 fusion also indicates that translocations affecting the AML1 gene can be associated with lymphoid, as well as myeloid, malignancy.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

The murine stk gene product, a transmembrane protein tyrosine kinase, is a receptor for macrophage-stimulating protein.

Macrophage-stimulating protein (MSP) was originally identified as an inducer of murine resident peritoneal macrophage responsiveness to chemoattractants. We recently showed that the product of RON, a protein tyrosine kinase cloned from a human keratinocyte library, is the receptor for MSP. Similarity of murine stk to RON led us to determine if the stk gene product is the murine receptor for MSP. Radiolabeled MSP could bind to NIH 3T3 cells transfected with murine stk cDNA (3T3/stk). Binding was saturable and was inhibited by unlabeled MSP but not by structurally related proteins, including hepatocyte growth factor and plasminogen. Specific binding to STK was demonstrated by cross-linking of 125I-labeled MSP to membrane proteins of 3T3/stk cells, which resulted in a protein complex with a molecular mass of 220 kDa. This radiolabeled complex comprised 125I-MSP and STK, since it could be immunoprecipitated by antibodies to the STK beta chain. Binding of MSP to stk cDNA-transfected cells induced tyrosine phosphorylation of the 150-kDa STK beta chain within 1 min and caused increased motile activity. These results establish the murine stk gene product as a specific transmembrane protein tyrosine kinase receptor for MSP. Inasmuch as the stk cDNA was cloned from a hematopoietic stem cell, our data suggest that in addition to macrophages and keratinocytes, a cell in the hematopoietic lineage may also be a target for MSP.

Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster.

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

S100B up-regulates macrophage production of IL1β and CCL22 and influences severity of retinal inflammation

Funding: This work was supported by funding awards to Dr Isabel Crane from the National Eye Research Centre, Bristol, UK (Grant ref. SCIAD 058); and NHS Grampian Endowment Trust (Grant ref. 10/16). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Portable 3D laser-camera calibration system with color fusion for SLAM

Nowadays, the use of RGB-D sensors have focused a lot of research in computer vision and robotics. These kinds of sensors, like Kinect, allow to obtain 3D data together with color information. However, their working range is limited to less than 10 meters, making them useless in some robotics applications, like outdoor mapping. In these environments, 3D lasers, working in ranges of 20-80 meters, are better. But 3D lasers do not usually provide color information. A simple 2D camera can be used to provide color information to the point cloud, but a calibration process between camera and laser must be done. In this paper we present a portable calibration system to calibrate any traditional camera with a 3D laser in order to assign color information to the 3D points obtained. Thus, we can use laser precision and simultaneously make use of color information. Unlike other techniques that make use of a three-dimensional body of known dimensions in the calibration process, this system is highly portable because it makes use of small catadioptrics that can be placed in a simple manner in the environment. We use our calibration system in a 3D mapping system, including Simultaneous Location and Mapping (SLAM), in order to get a 3D colored map which can be used in different tasks. We show that an additional problem arises: 2D cameras information is different when lighting conditions change. So when we merge 3D point clouds from two different views, several points in a given neighborhood could have different color information. A new method for color fusion is presented, obtaining correct colored maps. The system will be tested by applying it to 3D reconstruction.