A molecular marker that is specific to medicinal rhubarb based on chloroplast trnL/trnF sequences

"Da-Huang" (Radix et Rhizoma Rhei, medicinal rhubarb), a famous and important Traditional Chinese Medicine, has often been confused with the adulterant species in the same genus, Rheum. Through sequencing the trnL (UAA)/trnF (GAA) regions of chloroplast DNA of thirteen species of Rheum (three medicinal rhubarb species and ten adulterant ones), a molecular marker of the medicinal species was found. A pair of PCR primers based on the sequences, was thus designed, which amplified a highly specific DNA fragment in medicinal rhubarb exclusively, and absent in the adulterants at all under an optimized PCR condition.

A homogeneous DNA hybridization system by using a new luminescence terbium chelate

Homogeneous DNA hybridization assay based on the luminescence resonance energy transfer (LRET) from a new luminescence terbium chelate, N,N,N-1,N-1-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)-4-phenylpyridine]tetrakis(acetic acid) (BPTA)-Tb3+ (lambda(ex) = 325 nm and lambda(em) = 545 nm) to an organic dye, Cy3 (A,. = 548 nm and A,. = 565 nm), has been developed. In the system, two DNA probes whose sequences are complementary to the two different consecutive sequences of a target DNA are used; one of the probes is labeled with the Tb3+ chelate at the T-end, and the other is with Cy3 at the 5'-end. Labeling of the Tb3+ chelate is accomplished via the linkage of a biotin-labeled DNA probe with the Tb3+ chelate-labeled streptavidin. Strong sensitized emission of Cy3 was observed upon excitation of the Tb3+ chelate at 325 run, when the two probe DNAs were hybridized with the target DNA. The sensitivity of the assay was very high compared with those of the previous homogeneous-format assays using the conventional organic dyes; the detection limit of the present assay is about 30 pM of the target DNA strand.

Secondary structure effects on DNA hybridization kinetics: a solution versus surface comparison

The hybridization kinetics for a series of designed 25mer probe�target pairs having varying degrees of secondary structure have been measured by UV absorbance and surface plasmon resonance (SPR) spectroscopy in solution and on the surface, respectively. Kinetic rate constants derived from the resultant data decrease with increasing probe and target secondary structure similarly in both solution and surface environments. Specifically, addition of three intramolecular base pairs in the probe and target structure slow hybridization by a factor of two. For individual strands containing four or more intramolecular base pairs, hybridization cannot be described by a traditional two-state model in solution-phase nor on the surface. Surface hybridization rates are also 20- to 40-fold slower than solution-phase rates for identical sequences and conditions. These quantitative findings may have implications for the design of better biosensors, particularly those using probes with deliberate secondary structure.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DNA from pollen: principles and potential

This paper describes our recent extraction of ancient DNA (aDNA) from Holocene pollen and discusses the potential of the technique for elucidating timescales of evolutionary change. We show that plastid DNA is recoverable and usable from pollen grains of Scots pine Pinus sylvestris from 10 ka and 100 years ago. Comparison of the ancient sequences with modern sequences, obtained from an extant population, establish a first genetic link between modern and fossil samples of Scots pine, providing a genetic continuity through time. One common haplotype is present in each of the three periods investigated, suggesting that it persisted near the lake throughout the postglacial. The retrieval of aDNA from pollen has major implications for palaeoecology by allowing (i) investigation of population level dynamics in time and space, and (ii) tracing ancestry of populations and developing phylogenetic trees that include extinct as well as extant taxa. The method should work over the last glacial oscillation, thus giving access to ancestry of populations over a crucial period of time for the understanding of the relationship between speciation and climate change.

Specific and sensitive detection of Nosema bombi (Microsporidia : Nosematidae) in bumble bees (Bombus spp.; Hymenoptera : Apidae) by PCR of partial rRNA gene sequences

A polymerase chain reaction (PCR) based method was developed for the specific and sensitive diagnosis of the microsporidian parasite Nosema bombi in bumble bees (Bombus spp.). Four primer pairs, amplifying ribosomal RNA (rRNA) gene fragments, were tested on N. bombi and the related microsporidia Nosema apis and Nosema ceranae, both of which infect honey bees. Only primer pair Nbombi-SSU-Jf1/Jr1 could distinguish N. bombi (323 bp amplicon) from these other bee parasites. Primer pairs Nbombi-SSU-Jf1/Jr1 and ITS-f2/r2 were then tested for their sensitivity with N. bombi spore concentrations from 107 down to 10 spores diluted in 100 mu l of either (i) water or (ii) host bumble bee homogenate to simulate natural N. bombi infection (equivalent to the DNA from 10(6) spores down to 1 spore per PCR). Though the N. bombi-specific primer pair Nbombi-SSU-Jf1/Jr1 was relatively insensitive, as few as 10 spores per extract (equivalent to 1 spore per PCR) were detectable using the N. bombi-non-specific primer pair ITS-f2/r2, which amplifies a short fragment of similar to 120 bp. Testing 99 bumble bees for N. bombi infection by light microscopy versus PCR diagnosis with the highly sensitive primer pair ITS-f2/r2 showed the latter to b more accurate. PCR diagnosis of N. bombi using a combination of two primer pairs (Nbombi-SSU-Jf1/Jr1 and ITS-f2/r2) provides increased specificity, sensitivity, and detection of all developmental stages compared with light microscopy. (c) 2005 Elsevier Inc. All rights reserved.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Molecular diagnosis for heterogeneous genetic diseases with high-throughput DNA sequencing applied to retinitis pigmentosa

BACKGROUND:
The genetic heterogeneity of many Mendelian disorders, such as retinitis pigmentosa which results from mutations in over 40 genes, is a major obstacle to obtaining a molecular diagnosis in clinical practice. Targeted high-throughput DNA sequencing offers a potential solution and was used to develop a molecular diagnostic screen for patients with retinitis pigmentosa.
METHODS:
A custom sequence capture array was designed to target the coding regions of all known retinitis pigmentosa genes and used to enrich these sequences from DNA samples of five patients. Enriched DNA was subjected to high-throughput sequencing singly or in pools, and sequence variants were identified by alignment of up to 10 million reads per sample to the normal reference sequence. Potential pathogenicity was assessed by functional predictions and frequency in controls.
RESULTS AND CONCLUSIONS:
Known homozygous PDE6B and compound heterozygous CRB1 mutations were detected in two patients. A novel homozygous missense mutation (c.2957A?T; p.N986I) in the cyclic nucleotide gated channel ß1 (CNGB1) gene predicted to have a deleterious effect and absent in 720 control chromosomes was detected in one case in which conventional genetic screening had failed to detect mutations. The detection of known and novel retinitis pigmentosa mutations in this study establishes high-throughput DNA sequencing with DNA pooling as an effective diagnostic tool for heterogeneous genetic diseases.

Analysis of transduction in wastewater bacterial populations by targeting the phage-derived 16S rRNA gene sequences

Bacterial 16S rRNA genes transduced by bacteriophages were identified and analyzed in order to estimate the extent of the bacteriophage-mediated horizontal gene transfer in the wastewater environment. For this purpose, phage and bacterial DNA was isolated from the oxidation tank of a municipal wastewater treatment plant. Phylogenetic analysis of the 16S rRNA gene sequences cloned from a phage metagenome revealed that bacteriophages transduce genetic material in several major groups of bacteria. The groups identified were as follows: Betaproteobacteria, Gammaproteobacteria, Alphaproteobacteria, Actinomycetales and Firmicutes. Analysis of the 16S rRNA gene sequences in the total bacterial DNA from the same sample revealed that several bacterial groups found in the oxidation tank were not present in the phage metagenome (e.g. Deltaproteobacteria, Nitrospira, Planctomycetes and many Actinobacteria genera). These results suggest that transduction in a wastewater environment occurs in several bacterial groups; however, not all species are equally involved into this process. The data also showed that a number of distinctive bacterial strains participate in transduction-mediated gene transfer within identified bacterial groupings. Denaturing gradient gel electrophoresis analysis confirmed that profiles of the transduced 16S rRNA gene sequences and those present in the whole microbial community show significant differences.

Label-free detection of nanomolar unmodified single- and double-stranded dna by using surface-enhanced raman spectroscopy on Ag and Au colloids

Unlabelled single- and double-stranded DNA (ssDNA and dsDNA, respectively) has been detected at concentrations =10-9?M by surface-enhanced Raman spectroscopy. Under appropriate conditions the sequences spontaneously adsorbed to the surface of both Ag and Au colloids through their nucleobases; this allowed highly reproducible spectra with good signal-to-noise ratios to be recorded on completely unmodified samples. This eliminated the need to promote absorption by introducing external linkers, such as thiols. The spectra of model ssDNA sequences contained bands of all the bases present and showed systematic changes when the overall base composition was altered. Initial tests also showed that small but reproducible changes could be detected between oligonucleotides with the same bases arranged in a different order. The spectra of five ssDNA sequences that correspond to different strains of the Escherichia coli bacterium were found to be sufficiently composition-dependent so that they could be differentiated without the need for any advanced multivariate data analysis techniques.

Detection of single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer using a fluorophore-tagged DNA probe

Single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer were identified using oligodeoxynucleotide probe sequences bearing internal anthracene fluorophores proximal to the SNP site. Depending upon the nature of the synthesised target sequences, probe-target duplex formation could lead to enhanced or attenuated fluorescence emission from the anthracene, enabling detection of a proximal base-pair as either matching or mismatching. © 2011 Elsevier Ltd. All rights reserved.

Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target DNA while Au-NPs modified with oligonucleotide detection sequences played a role in recognition and signal production. Due to the much lower stability of mismatched DNA strands caused by unstable duplex structures in solutions of relatively low salt concentration, hybridization efficiency in the presence of different buffers was well investigated, and thus, the optimized salt concentration allowed for discrimination of single-mismatched DNA (MMT) from perfectly matched DNA (PMT). Therefore, quantitative information concerning the target analyte was translated into a colorimetric signal, which could easily and quantitatively measured by low-cost UV–vis spectrophotometric analysis. The results indicated this to be a very simple and economic strategy for detection of single-mismatched DNA strands.

Discovery of DNA hypermethylation using a DHPLC screening strategy

Promoter hypermethylation is recognized as a hallmark of human cancer, in addition to conventional mechanisms of gene inactivation. As such, many new technologies have been developed over the past two decades to uncover novel targets of methylation and decipher complex epigenetic patterns. However, many of these are either labor intensive or provide limited data, confined to oligonucleotide hybridization sequences or enzyme cleavage sites and cannot be easily applied to screening large sets of sequences or samples. We present an application of denaturing high performance liquid chromatography (DHPLC), which relies on bisulfite modification of genomic DNA, for methylation screening. We validated DHPLC as a methylation screening tool using GSTP1, a well known target of methylation in prostate cancer. We developed an in silico approach to identify potential targets of promoter hypermethylation in prostate cancer. Using DHPLC, we screened two of these targets LGALS3 and SMAD4 for methylation. We show that DHPLC has an application as a fast, sensitive, quantitative and cost effective method for screening novel targets or DNA samples for DNA methylation.

PCR amplification of short tandem repeat sequences allows serial studies of chimaerism/engraftment following BMT in rodents

Animal models of bone marrow transplantation (BMT) allow evaluation of new experimental treatment strategies. One potential strategy involves the treatment of donor marrow with ultra-violet B light to allow transplantation across histocompatibility boundaries without an increase in graft rejection or graft-versus-host disease. A major requirement for a new experimental protocol, particularly if it involves manipulation of the donor marrow, is that the manipulated marrow gives rise to long-term multilineage engraftment. DNA based methodologies are now routinely used by many centres to evaluate engraftment and degree of chimaerism post-BMT in humans. We report the adaptation of this methodology to the serial study of engraftment in rodents. Conditions have been defined which allow analysis of serial tail vein samples using PCR of short tandem repeat sequences (STR-PCR). These markers have been used to evaluate the contribution of ultraviolet B treated marrow to engraftment following BMT in rodents without compromising the health of the animals under study. Chimaerism data from sequential tail vein samples and bone marrow from selected sacrificed animals showed excellent correlation, thus confirming the validity of this approach in analysing haemopoietic tissue. Thus the use of this assay may facilitate experimental studies in animal BMT.

Análise de tripletos e de repetições em estruturas primárias de DNA

O desenvolvimento de equipamentos de descodificação massiva de genomas veio aumentar de uma forma brutal os dados disponíveis. No entanto, para desvendarmos informação relevante a partir da análise desses dados é necessário software cada vez mais específico, orientado para determinadas tarefas que auxiliem o investigador a obter conclusões o mais rápido possível. É nesse campo que a bioinformática surge, como aliado fundamental da biologia, uma vez que tira partido de métodos e infra-estruturas computacionais para desenvolver algoritmos e aplicações informáticas. Por outro lado, na maior parte das vezes, face a novas questões biológicas é necessário responder com novas soluções específicas, pelo que o desenvolvimento de aplicações se torna um desafio permanente para os engenheiros de software. Foi nesse contexto que surgiram os principais objectivos deste trabalho, centrados na análise de tripletos e de repetições em estruturas primárias de DNA. Para esse efeito, foram propostos novos métodos e novos algoritmos que permitirem o processamento e a obtenção de resultados sobre grandes volumes de dados. Ao nível da análise de tripletos de codões e de aminoácidos foi proposto um sistema concebido para duas vertentes: por um lado o processamento dos dados, por outro a disponibilização na Web dos dados processados, através de um mecanismo visual de composição de consultas. Relativamente à análise de repetições, foi proposto e desenvolvido um sistema para identificar padrões de nucleótidos e aminoácidos repetidos em sequências específicas, com particular aplicação em genes ortólogos. As soluções propostas foram posteriormente validadas através de casos de estudo que atestam a mais-valia do trabalho desenvolvido.