1000 resultados para Checkerboard DNA-DNA hybridisation
Resumo:
Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.
Resumo:
In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.
Resumo:
Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004
Resumo:
Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin
Resumo:
Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.
Resumo:
A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.
Resumo:
Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.
Resumo:
The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
PURPOSE: To assess the usefulness of combining hyperthermia with a DNA repair inhibitor (double-strand break bait [Dbait]) and its potential application to radiofrequency ablation (RFA) in a preclinical model of human colorectal cancer. MATERIALS AND METHODS: The local ethics committee of animal experimentation approved all investigations. First, the relevance was assessed by studying the survival of four human colorectal adenocarcinoma cell cultures after 1 hour of hyperthermia at 41°C or 43°C with or without Dbait. Human colon adenocarcinoma cells (HT-29) were grafted subcutaneously into nude mice (n = 111). When tumors reached approximately 500 mm(3), mice were treated with Dbait alone (n = 20), sublethal RFA (n = 21), three different Dbait schemes and sublethal RFA (n = 52), or a sham treatment (n = 18). RFA was performed to ablate the tumor center alone. To elucidate antitumor mechanisms, 39 mice were sacrificed for blinded pathologic analysis, including assessment of DNA damage, cell proliferation, and tumor necrosis. Others were monitored for tumor growth and survival. Analyses of variance and log-rank tests were used to evaluate differences. RESULTS: When associated with mild hyperthermia, Dbait induced cytotoxicity in all tested colon cancer cell lines. Sublethal RFA or Dbait treatment alone moderately improved survival (median, 40 days vs 28 days for control; P = .0005) but combination treatment significantly improved survival (median, 84 days vs 40 days for RFA alone, P = .0004), with approximately half of the animals showing complete tumor responses. Pathologic studies showed that the Dbait and RFA combination strongly enhances DNA damage and coagulation areas in tumors. CONCLUSION: Combining Dbait with RFA sensitizes the tumor periphery to mild hyperthermia and increases RFA antitumor efficacy.
Resumo:
Comment on: Witz G, et al. Proc Natl Acad Sci USA 2011; 108:3608-11.
Resumo:
In the presence of 2-hydroxybiphenyl, the enhancer binding protein, HbpR, activates the sigma54-dependent P(hbpC) promoter and controls the initial steps of 2-hydroxybiphenyl degradation in Pseudomonas azelaica. In the activation process, an oligomeric HbpR complex of unknown subunit composition binds to an operator region containing two imperfect palindromic sequences. Here, the HbpR-DNA binding interactions were investigated by site-directed mutagenesis of the operator region and by DNA-binding assays using purified HbpR. Mutations that disrupted the twofold symmetry in the palindromes did not affect the binding affinity of HbpR, but various mutations along a 60 bp region, and also outside the direct palindromic sequences, decreased the binding affinity. Footprints of HbpR on mutant operator fragments showed that a partial loss of binding contacts occurs, suggesting that the binding of one HbpR 'protomer' in the oligomeric complex is impaired whilst leaving the other contacts intact. An HbpR variant, devoid of its N-terminal sensing A-domain, was unable to activate transcription from the hbpC promoter while maintaining protection of the operator DNA in footprints. Wild-type HbpR was unable to activate transcription from the hbpC promoter when delta A-HbpR was expressed in the same cell, suggesting the formation of (repressing) hetero-oligomers. This model implies that HbpR can self-associate on its operator DNA without effector recognition or ATP binding. Furthermore, our findings suggest that the N-terminal sensing domain of HbpR is needed to activate the central ATPase domain rather than to repress a constitutively active C domain, as is the case for the related regulatory protein XylR.