Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Constitutive production of granulocyte/macrophage colony-stimulating factor by hypodense mononuclear eosinophils developed in vitro from hybrid eosinophil/basophil granulocytes.

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Persistent elevations of cerebrospinal fluid concentrations of corticotropin-releasing factor in adult nonhuman primates exposed to early-life stressors: implications for the pathophysiology of mood and anxiety disorders.

There is increasing evidence for an important role of adverse early experience on the development of major psychiatric disorders in adulthood. Corticotropin-releasing factor (CRF), an endogenous neuropeptide, is the primary physiological regulator of the mammalian stress response. Grown nonhuman primates who were exposed as infants to adverse early rearing conditions were studied to determine if long-term alterations of CRF neuronal systems had occurred following the early stressor. In comparison to monkeys reared by mothers foraging under predictable conditions, infant monkeys raised by mothers foraging under unpredictable conditions exhibited persistently elevated cerebrospinal fluid (CSF) concentrations of CRF. Because hyperactivity of CRF-releasing neurons has been implicated in the pathophysiology of certain human affective and anxiety disorders, the present finding provides a potential neurobiological mechanism by which early-life stressors may contribute to adult psychopathology.

Inhibition of human immunodeficiency virus type 1 transcription and replication by DNA sequence-selective plant lignans.

A plant lignan, 3'-O-methyl nordihydroguaiaretic acid (3'-O-methyl NDGA, denoted Malachi 4:5-6 or Mal.4; molecular weigth 316), was isolated from Larrea tridentata and found to be able to inhibit human immunodeficiency virus (HIV) Tat-regulated transactivation in vivo, induce protection of lymphoblastoid CEM-SS cells from HIV (strain IIIB) killing, and suppress the replication of five HIV-1 strains (WM, MN, VS, JR-CSF, and IIIB) in mitogen-stimulated peripheral blood mononuclear cells, all in a dose-dependent manner. Mal.4 inhibits both basal transcription and Tat-regulated transactivation in vitro. The target of Mal.4 has been localized to nucleotides -87 to -40 of the HIV long terminal repeat. Mal.4 directly and specifically interferes with the binding of Sp1 to Sp1 sites in the HIV long terminal repeat. By inhibiting proviral expression, Mal.4 may be able to interrupt the life cycles of both wild-type and reverse transcriptase or protease mutant viruses in HIV-infected patients.

Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Rescue of defective mitogenic signaling by D-type cyclins.

Three gene products, including Myc and the D- and E-type G1 cyclins, are rate limiting for G1 progression in mammalian fibroblasts. Quiescent mouse NIH 3T3 fibroblasts engineered to express a mutant colony-stimulating factor (CSF-1) receptor (CSF-1R 809F) fail to synthesize c-myc and cyclin D1 mRNAs upon CSF-1 stimulation and remain arrested in early G1 phase. Ectopic expression of c-myc or either of three D-type cyclin genes, but not cyclin E, resensitized these cells to the mitogenic effects of CSF-1, enabling them to proliferate continuously in liquid culture and to form colonies in agar in response to the growth factor. Rescue by cyclin D1 was enhanced by c-myc but not by cyclin E and was reversed by infecting cyclin D1-reconstituted cells with a retroviral vector encoding catalytically inactive cyclin-dependent kinase 4. Induction of cyclin D1 mRNA by CSF-1 was restored in cells forced to express c-myc, and vice versa, suggesting that expression of the two genes is interdependent. Cells reconstituted with c-myc were prevented from entering S phase when microinjected with a monoclonal antibody to cyclin D1, and conversely, those rescued by cyclin D1 were inhibited from forming CSF-1-dependent colonies when challenged with a dominant-negative c-myc mutant. Cyclin D mutants defective in binding to the retinoblastoma protein were impaired in rescuing mitogenic signaling. Therefore, Myc and D-type cyclins collaborate during the mitogenic response to CSF-1, whereas cyclin E functions in a separate pathway.

Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Inhibitory effect of 9-(2-phosphonylmethoxyethyl)adenine on visna virus infection in lambs: a model for in vivo testing of candidate anti-human immunodeficiency virus drugs.

The acyclic nucleoside phosphonate analog 9-(2-phosphonylmethoxyethyl)adenine (PMEA) was recently found to be effective as an inhibitor of visna virus replication and cytopathic effect in sheep choroid plexus cultures. To study whether PMEA also affects visna virus infection in sheep, two groups of four lambs each were inoculated intracerebrally with 10(6.3) TCID50 of visna virus strain KV1772 and treated subcutaneously three times a week with PMEA at 10 and 25 mg/kg, respectively. The treatment was begun on the day of virus inoculation and continued for 6 weeks. A group of four lambs were infected in the same way but were not treated. The lambs were bled weekly or biweekly and the leukocytes were tested for virus. At 7 weeks after infection, the animals were sacrificed, and cerebrospinal fluid (CSF) and samples of tissue from various areas of the brain and from lungs, spleen, and lymph nodes were collected for isolation of virus and for histopathologic examination. The PMEA treatment had a striking effect on visna virus infection, which was similar for both doses of the drug. Thus, the frequency of virus isolations was much lower in PMEA-treated than in untreated lambs. The difference was particularly pronounced in the blood, CSF, and brain tissue. Furthermore, CSF cell counts were much lower and inflammatory lesions in the brain were much less severe in the treated lambs than in the untreated controls. The results indicate that PMEA inhibits the propagation and spread of visna virus in infected lambs and prevents brain lesions, at least during early infection. The drug caused no noticeable side effects during the 6 weeks of treatment.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Impacto no sistema imunológico da utilização prolongada de morfina para tratamento da dor

Introdução. Apesar das evidências dos efeitos imunomodulatórios da morfina, não há na literatura estudos que tenham comparado a interação entre citocinas, imunidade celular (linfócitos T, B e NK) e a administração prolongada de morfina administrada pelas vias oral ou intratecal em doentes com dor crônica neuropática não relacionada ao câncer. Foram avaliados de forma transversal e comparativa 50 doentes com diagnóstico de dor lombar crônica e com presença de radiculopatia (dor neuropática) previamente operados para tratar hérnia discal lombar (Síndrome Dolorosa Pós- Laminectomia), sendo 18 doentes tratados prolongadamente com infusão de morfina pela via intratecal com uso de sistema implantável no compartimento subaracnóideo (grupo intratecal); 17 doentes tratados prolongadamente com morfina pela via oral (n=17) e 15 doentes tratados com fármacos mas sem opióides (grupo sem opioide). Foram analisadas as concentração das citocinas IL-2, IL-4, IL-8, TNFalfa, IFNy, IL-5, GM-CSF, IL-6, IL-10 e IL-1beta no plasma e no líquido cefalorraquidiano; imunofenotipagem de linfócitos T, B e células NK e avaliados os Índice de Escalonamento de Opióide (em percentagem de opióide utilizada e em mg), dose cumulativa de morfina (mg), duração do tratamento em meses, dose final de morfina utilizada (em mg), e equivalente de morfina por via oral (em mg). Resultados. Não houve diferença estatisticamente significativa entre o número de linfócitos T, B e NK nos doentes com morfina administrada pelas vias IT, VO e os não usuários de morfina. Houve correlação positiva entre as concentrações de linfócitos T CD4 e o Índice de Escalonamento de Opióide (em % e mg) nos doentes tratados com morfina por via intratecal. Houve correlação negativa entre as concentrações de células NK (CD56+) e o Índice de Escalonamento de Opióide (em % e mg) nos doentes tratados com morfina por via intratecal. Houve correlação positiva entre o número de células NK (CD56+) e a dose cumulativa de morfina (em mg) administrada pelas vias intratecal e oral. Houve correlação positiva entre as concentrações de linfócitos T CD8 e a duração do tratamento em meses nos doentes tratados com morfina pela via oral. As concentrações de IL-8 e IL-1beta foram maiores no LCR do que no plasma em todos os doentes da amostra analisada. As concentrações de IFNy no LCR foram maiores nos doentes que utilizavam morfina pela via oral e nos não usuários de morfina do que nos que a utilizavam pela via intratecal. As concentrações de plasmáticas de IL-5 foram maiores nos doentes utilizavam morfina pela via oral ou intratecal do que nos que não a utilizavam. A concentração de IL-5 no LCR correlacionou-se negativamente com a magnitude da dor de acordo com a EVA nos doentes tratados com morfina pelas via oral ou intratecal. Nos doentes tratados com morfina pelas via oral ou intratecal, a concentração de IL-2 no LCR correlacionou-se positivamente com a magnitude da dor de acordo com a EVA e negativamente com o Índice de Escalonamento de Opióide (em % e mg) e a dose cumulativa de morfina (em mg). As concentrações plasmáticas de GMCSF foram maiores nos doentes utilizavam morfina pela via oral ou intratecal do que nos não a utilizavam. A concentração de TNFalfa no LCR nos doentes tratados com morfina pela via intratecal correlacionou-se negativamente com o Índice de Escalonamento de Opióide (em % e mg), a dose cumulativa de morfina (em mg) e dose equivalente por via oral (em mg) de morfina. A concentração plasmática das citocinas IL-6 e IL-10 correlacionou-se negativamente com a duração do tratamento (em meses) nos doentes tratados com morfina administrada pela via oral. O Índice de Escalonamento de Opióide (em mg e %) correlacionou-se negativamente com as concentrações no LCR de IL-2 e TNFalfa nos doentes tratados com morfina administrada pela via intratecal. O Índice de Escalonamento de Opióide (em mg e %) correlacionou-se negativamente com as concentrações no LCR de IL-2 e IL-5 nos doentes tratados com morfina administrada pela via oral. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações de IL-5 e IL-2 no LCR nos doentes tratados com morfina administrada pelas vias oral e intratecal. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações plasmáticas de IL-4 nos doentes tratados com morfina administrada pela via intratecal. Houve correlação negativa entre a intensidade da dor de acordo com a EVA e as concentrações plasmáticas de IL-1beta nos doentes tratados com morfina administrada pela via intratecal. Conclusões: Os resultados sugerem associações entre citocinas e imunidade celular (células T , B e NK) e o tratamento prolongado com morfina administrada pela via oral ou intratecal. Estes resultados podem contribuir para a compreensão da imunomodulação da morfina administrada por diferentes vias em doentes com dor neuropática crônica não oncológica . São necessários mais estudos sobre os efeitos da morfina sobre o sistema imunológico

Visual function alterations in essential tremor: A case report

Our purpose is to report alterations in contrast sensitivity function (CSF) and in the magno, parvo and koniocellular visual pathways by means of a multichannel perimeter in case of an essential tremor (ET). A complete evaluation of the visual function was performed in a 69-year old patient, including the analysis of the chromatic discrimination by the Fansworth–Munsell 100 hue test, the measurement of the CSF by the CSV-1000E test, and the detection of potential alteration patterns in the magno, parvo and koniocellular visual pathways by means of a multichannel perimeter. Visual acuity and intraocular pressure (IOP) were within the ranges of normality in both eyes. No abnormalities were detected in the fundoscopic examination and in the optical coherence tomography (OCT) exam. The results of the color vision examination were also within the ranges of normality. A significant decrease in the achromatic CSFs for right eye (RE) and left eye (LE) was detected for all spatial frequencies. The statistical global values provided by the multichannel perimeter confirms that there were significant absolute sensitivity losses compared to the normal pattern in RE. In the LE, only a statistically significant decrease in sensitivity was detected for the blue-yellow (BY) channel. The pattern standard deviation (PSD) values obtained in our patient indicated that there were significant localized losses compared to the normality pattern in the achromatic channel of the RE and in the red-green (RG) channel of the LE. Some color vision alterations may be present in ET that cannot be detected with conventional color vision tests, such as the FM 100 Hue.

Participación de las células supresoras mieloides (CSM) y T regulatorias (Treg) en el control de la infección con Trypanosoma cruzi y el desarrollo de la patología inflamatoria asociada a la infeccion

La infección de mamíferos con el T. cruzi resulta en diferentes alteraciones inmunológicas que permiten la persistencia crónica del parásito y destrucción inflamatoria progresiva del tejido cardiaco, nervioso y hepático. Los mecanismos responsables de la patología de la enfermedad de Chagas han sido materia de intensa investigación habiéndose propuesto que el daño producido en esta enfermedad puede ser consecuencia de la respuesta inflamatoria del individuo infectado y/o de una acción directa del parásito sobre los tejidos del hospedador. El propósito del presente proyecto es estudiar comparativamente, en dos cepas de ratones con diferente susceptibilidad a la infección y desarrollo de patología, la participación y los mecanismos efectores de las células supresoras mieloides (CSM) y las celulas T regulatorias inducidas por la infección experimental con Trypanosoma cruzi en el control de la infección con este protozoario y en el desarrollo de la patología hepática siendo los objetivos especificos desarrolar: - Investigar la generación y/o reclutamiento de células de CSM en bazo e hígado de ratones infectados con Trypanosoma cruzi y su contribución a la desigual susceptibilidad a la infección y respuesta inmune desarrollada en las cepas de ratones BALB/c y C57BL/6; - Investigar la capacidad de las CSM inducidas por la infección con T. cruzi en bazo e hígado de ratones de ambas cepas para suprimir la respuesta de células T in vitro e indagar sobre los mecanismos de supresión utilizados; - Investigar la generación y/o reclutamiento de células Treg durante la infección experimental con Trypanosoma cruzi, su participación en la desigual susceptibilidad a la infección y respuesta inmune desarrollada en ambas cepas de ratones y los mecanismos de supresión utilizados. - Analizar en tejido hepático o leucocitos infiltrantes la presencia de COX2, PGE2, MMP2 y 9, IL1b, IL6, IDO, IL10 y GM-CSF capaces de inducir la expansión de las CSM; - Dilucidar si la administración del ligando para TLR2 (Pam3CyS) previo a la infección de ratones C57BL/6 (en los cuales se detecta un menor número de CSM) es capaz de modular la respuesta inflamatoria y el daño hepático a través de la inducción de CSM y/o T reg en hígado y bazo. La comprension de los eventos celulares y moleculares que regulan la producción de citoquinas pro- y anti-inflamatorias y otros mediadores, así como el papel de los receptores de la inmunidad innata durante la infección con T. cruzi contribuirá a responder interrogantes que son claves para el diseño de nuevas estrategias de intervención inmune tendientes a preservar los mecanismos de defensa del huésped.