Numerical simulation of double-diffusion driven convective flow and rock alteration in three-dimensional fluid-saturated geological fault zones

Numerical methods are used to simulate the double-diffusion driven convective pore-fluid flow and rock alteration in three-dimensional fluid-saturated geological fault zones. The double diffusion is caused by a combination of both the positive upward temperature gradient and the positive downward salinity concentration gradient within a three-dimensional fluid-saturated geological fault zone, which is assumed to be more permeable than its surrounding rocks. In order to ensure the physical meaningfulness of the obtained numerical solutions, the numerical method used in this study is validated by a benchmark problem, for which the analytical solution to the critical Rayleigh number of the system is available. The theoretical value of the critical Rayleigh number of a three-dimensional fluid-saturated geological fault zone system can be used to judge whether or not the double-diffusion driven convective pore-fluid flow can take place within the system. After the possibility of triggering the double-diffusion driven convective pore-fluid flow is theoretically validated for the numerical model of a three-dimensional fluid-saturated geological fault zone system, the corresponding numerical solutions for the convective flow and temperature are directly coupled with a geochemical system. Through the numerical simulation of the coupled system between the convective fluid flow, heat transfer, mass transport and chemical reactions, we have investigated the effect of the double-diffusion driven convective pore-fluid flow on the rock alteration, which is the direct consequence of mineral redistribution due to its dissolution, transportation and precipitation, within the three-dimensional fluid-saturated geological fault zone system. (c) 2005 Elsevier B.V. All rights reserved.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Multifidus muscle recovery is not automatic after resolution of acute, first-episode low back pain

Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.

Hemodynamic Changes during Myocardial Revascularization without Extracorporeal Circulation

Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.

Urodynamic evaluation of patients with lower urinary tract symptoms and small prostate volume

Introduction: The relevance of prostate size in the pathophysiology of lower urinary tract symptoms (LUTS) is controversial. We evaluated the urodynamic findings in patients with LUTS and small prostate volumes. Materials and Methods: 84 patients aged >= 50 years with LUTS and prostates < 40 ml were evaluated. All had an International Prostate Symptom Score (IPSS) >= 8. Average age was 62.0 +/- 8.1 years. We evaluated the impact of bladder outlet obstruction (BOO) and detrusor overactivity (DO) on the voiding symptoms and urodynamic findings. Results: Mean prostate volume was 29.2 +/- 7.2 ml and mean IPSS was 13.5 +/- 4.6. BOO was the main finding, affecting 42 (50.0%) patients, followed by detrusor underactivity (DU) in 41 (48.8%) and DO in 28 (33.3%) patients. Patients without BOO were significantly older than the obstructed (64.0 +/- 8.8 and 60.1 +/- 6.9 years, respectively; p = 0.026) and had an increased prevalence of DU (76.2 and 21.4%, respectively; p < 0.001). Comparison of patients with and without DO showed reduced bladder capacity and compliance in the DO group (p < 0.001). No other comparisons were significant. Conclusion: Half of the patients with LUTS and small prostates are not obstructed and may have DO or decreased detrusor contractility as the basis for their voiding symptoms. Our results emphasize the value of urodynamics in this population, especially when invasive treatments are being considered. Copyright (c) 2008 S. Karger AG, Basel.

Bladder Compliance What Does it Represent: Can We Measure it, and is it Clinically Relevant?

Aims: To report the conclusion of the Think Thank 8 on Compliance Discussions during the second ICI-RS meeting in 2010. Methods: During a 3-day meeting a group of specialists discussed bladder compliance, what it represents, how it can be measured and if it is clinically relevant. Results: Bladder compliance is the result of a mathematical calculation of the volume required for a unit rise of pressure measured during a cystometric filling. It gives an indication on how the different mechanisms in the bladder wall react on stretching. There is a need of standardization of measurement and suggestions for this are given in the text. Pitfalls are described and how to avoid them. There is a wide range of compliance values in healthy volunteers and groups of patients. Poor compliance needs to be defined better as it can have significant clinical consequences. Prevention and treatment are discussed. Conclusion: If compliance is correctly measured and interpreted, it has importance in urodynamic testing and gives information relevant for clinical management. Neurourol. Urodynam. 30:714-722, 2011. (C) 2011 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A low-temperature insulating phase at v=1.5 for 2D holes in high-mobility SiSi1-xGex heterostructures with Landau level degeneracy

Magneto-transport measurements of the 2D hole system (2DHS) in p-type Si-Si1-xGex heterostructures identify the integer quantum Hall effect (IQHE) at dominantly odd-integer filling factors v and two low-temperature insulating phases (IPs) at v = 1.5 and v less than or similar to 0.5, with re-entrance to the quantum Hall effect at v = 1. The temperature dependence, current-voltage characteristics, and tilted field and illumination responses of the IP at v = 1.5 indicate that the important physics is associated with an energy degeneracy of adjacent Landau levels of opposite spin, which provides a basis for consideration of an intrinsic, many-body origin.

Combined glucosamine and chondroitin sulfate provides functional and structural benefit in the anterior cruciate ligament transection model

Evidence that combined glucosamine sulfate and chondroitin sulfate (Gluchon) or isolated glucosamine (Glu) modifies joint damage in osteoarthritis (OA) is still lacking. We studied joint pain and cartilage damage using the anterior cruciate ligament transection (ACLT) model. Wistar rats were subjected to ACLT of the right knee ( OA) or sham operation. Groups received either Glu (500 mg/kg), Gluchon (500 mg/kg glucosamine +400 mg/kg chondroitin) or vehicle (non-treated-NT) per os starting 7 days prior to ACLT until sacrifice at 70 days. Joint pain was evaluated daily using the rat-knee joint articular incapacitation test. Structural joint damage was assessed using histology and biochemistry as the chondroitin sulfate ( CS) content of cartilage by densitometry (microgram per milligram dried cartilage), comparing to standard CS. The molar weight (Mw) of the CS samples, used as a qualitative biochemical parameter, was obtained by comparing their relative mobility on a polyacrylamide gel electrophoresis to standard CS. Gluchon, but not Glu, significantly reduced joint pain (P<0.05) compared to NT. There was an increase in CS content in the OA group (77.7 +/- 8.3 mu g/mg) compared to sham (53.5 +/- 11.2 mu g/mg) (P<0.05). The CS from OA samples had higher Mw (4:62 +/- 0:24 x 10(4) g/mol) compared to sham (4:18 +/- 0:19 x 10(4) g/mol) (P<0.05). Gluchon administration significantly reversed both the increases in CS content (54.4 +/- 12.1 mu g/mg) and Mw (4:18 +/- 0:2 x 104 g/mol) as compared to NT. Isolated Glu decreased CS content though not reaching statistical significance. Cartilage histology alterations were also significantly prevented by Gluchon administration. Gluchon provides clinical (analgesia) and structural benefits in the ACLT model. This is the first demonstration that biochemical alterations occurring in parallel to histological damage in OA are prevented by Gluchon administration.

The remodeling of collagen fibers in rats ankles submitted to immobilization and muscle stretch protocol

To evaluate the remodeling of collagen fibers in the articular cartilage of rat ankles, with and without immobilization, after application of muscle stretching protocol. Twenty three Wistar rats were divided into four groups: immobilized (I), n = 6; immobilized and stretched (IS), n = 6; stretched (S), n = 6 and control (C), n = 5. The animals in groups I and IS were submitted to immobilization. After the period of immobilization, the animals in groups IS and S were submitted to a muscle stretching protocol. At the end of the experiment, the animals were euthanized and the joints removed, processed and stained with Picrosirius red. The analysis was carried out using a polarized light microscope. The density of collagen fibers were quantified according to the intensity of birefringence displayed. By way of statistical analyses, the right and left hind limbs of the different groups were compared based on the total density of collagen fibers, the density of thick collagen fibers and the density of thin collagen fibers. Immobilization promoted a reduction in density of the thin fibers and of total collagen. The muscle stretching protocol after immobilization promoted a reduction in density of the total collagen and of the thick fibers, but the density of the thin fibers showed the same values as control. The collagen fibers were remodeled by the different stimuli. Immobilization was harmful to the collagen fibers and the muscle stretching protocol only recovered the thin collagen fibers.

Lupus pleuritis: a relevant risk factor for pulmonary tuberculosis

The objective of the study was to evaluate risk factors for pulmonary tuberculosis in systemic lupus erythematosus (SLE). Clinical/laboratorial features of 1283 SLE patients (ACR criteria) followed at the Lupus Clinic were obtained from the electronic register database from 2001 to 2009. Pulmonary tuberculosis was diagnosed in 20 patients (1.6%) (TB+ group). As control group (TB-), 40 patients without tuberculosis matched for age, gender, ethnicity, age at SLE diagnosis, and disease duration were arbitrarily selected. All 20 patients of the TB+ group presented confirmed pulmonary tuberculosis from 1 to 23 years after SLE diagnosis (7.6 +/- 8.1 years). Frequencies of previous SLE involvements (cutaneous, articular, hematological, renal, pericarditis, pneumonitis, and central nervous system) were alike in TB+ and TB- groups (p > 0.05). In contrast, prior pleuritis was more frequent in the TB+ group (40% vs. 5%, p=0.001). In fact, pulmonary tuberculosis was diagnosed in 8/10 patients with previous pleuritis. Immunosuppressive and corticosteroid therapies at the moment of tuberculosis diagnosis were also similar in both groups (p > 0.05). We have identified pleuritis as a relevant risk factor for pulmonary tuberculosis, suggesting that previous pleural injury is a critical part of the complex interplay between altered immune system, socio-economic conditions, and increased susceptibility to this mycobacterial infection. Lupus (2010) 19, 1585-1590.

Male gender results in more severe lupus nephritis

Gender may produce different characteristics in the manifestation of systemic lupus erythematosus (SLE). The present study investigated the influence of gender on clinical, laboratory, autoantibodies and histopathological classes of lupus nephritis (LN). As much as 81 patients diagnosed with SLE (ACR criteria) and active nephritis, who underwent renal biopsy between 1999 and 2004, and who had frozen serum samples and clinical data available from the time of biopsy, were selected for this study. The presence of anti-P and antichromatin antibodies was measured using ELISA, and anti-dsDNA was measured using indirect immunofluorescence. All of the renal biopsies were reviewed in a blinded manner by the same expert renal pathologist. The charts were extensively reviewed for demographic and renal features obtained at the time of the biopsy. Of the 81 patients (13.6%), 11 were male SLE patients. Both male and female lupus patients were of similar age and race, and had similar durations of lupus and renal disease. The female patients had more cutaneous (95.7 vs. 45.5%, P = 0.0001) and haematological (52.9 vs. 18.2%, P = 0.04) involvements than the male SLE patients. In addition, the articular data, central nervous system analyses, serositis findings and SLEDAI scores were similar in both experimental groups. Positivity for anti-dsDNA, anti-ribosomal P and antichromatin did not differ between the two groups, and both groups showed similarly low C3 or C4 serum levels. Our analysis indicated that no histopathological class of LN was predominant in both males and females. Interestingly, the serum creatinine levels were higher in the male SLE patients compared to the female SLE group (3.16 +/- A 2.49 vs. 1.99 +/- A 1.54 mg/dL, P = 0.03), with an increased frequency of high creatinine (81.8 vs. 47.1%, P = 0.04) as well as renal activity index (7.6 +/- A 3.5 vs. 4.8 +/- A 3.5, P = 0.02). In addition, whilst the mean levels of proteinuria, cylindruria and serum albumin were markedly altered, they were comparable between both lupus men and women. Moreover, the frequencies of dialysis, renal transplantation and death were similar between the two groups. These data suggest that male patients had a more severe LN compared to women diagnosed with this renal abnormality.

Self-organization with traveling waves: A case for a convective torus

A traveling wave of BaSO4 in the chlorite-thiourea reaction has shown concentric precipitation patterns upon being triggered by the autocatalyst HOCl. The precipitation patterns show circular rings of alternate null and full precipitation regions. This self-organization appears to be the result of the formation of a convective torus. The formation of the convective torus can be described as a Benard-Marangoni instability with lateral heating.

Ligaments of the Posterior and Lateral Talar Processes: MRI and MR Arthrography of the Ankle and Posterior Subtalar Joint with Anatomic and Histologic Correlation

OBJECTIVE. MRI and combined ankle and posterior subtalar MR arthrography in cadavers were used to evaluate the ligaments of the posterior and lateral talar processes. Subsequent anatomic and histologic correlation was performed. MATERIALS AND METHODS. Ten cadaveric ankles were used. Routine radiography and MRI were initially performed. Ankle and posterior subtalar MR arthrography, followed by anatomic and histologic analysis, was then performed to allow better assessment of the ligaments of the lateral and posterior talar process. RESULTS. In all subjects, MR arthrography provided superior delineation of the articular and periarticular structures, as well as the ligaments. The lateral talocalcaneal and medial talocalcaneal ligaments were best seen in the axial and coronal planes, respectively. The axial plane was best for visualizing the fibulotalocalcaneal ligament, and the sagittal plane was best for evaluating the posterior talocalcaneal ligament. The anterior and posterior talofibular ligaments and the posterior tibiotalar ligament (superficial and deep portions) were best seen in the axial plane. Histologic analysis was correlated to anatomic sectioning and showed the attachment sites of these ligaments. CONCLUSION. Combined ankle and posterior subtalar MR arthrography enhances visualization of the ligaments attaching to the posterior and lateral talar processes, including the posterior, lateral, and medial talocalcaneal and fibulotalocalcaneal ligaments.

Structural analysis of three His32 mutants of DsbA: Support for an electrostatic role of His32 in DsbA stability

DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.