Excellent correlation between cathepsin B inhibition and cytotoxicity for a series of palladacycles

The reaction of the five- or six-membered C,N or C,S-palladacycles [(L)PdCl](2) with PTA (1,3,5-triaza-7-phosphaadamantane) led to the monomeric complexes [(L)Pd(PTA)Cl] 6a, 6b and 7 where LH= N,N-dimethyl-1-phenylmethanamine, benzyl(methyl)sulfane or 1-methyl-5-phenyl-1H-benzo[e][1,4]diazepin-2(3H)-one respectively. Dimeric complexes have also been synthesised: [Pd(2)L(2)(mu-dppe)Cl(2)], where LH = 1-methyl-5-phenyl-1H-benzo[e][1,4]diazepin-2(3H)-one (1a), (R)- or (S)-3-isopropyl-1-methyl-5-phenyl-1H-benzo[e][1,4]diazepin-2(3H)-one (1b, 1c), [Pd(2)L(2)(mu-dppf)Cl(2)], where L= 1-methyl-5-phenyl-1H-benzo[e][1,4]diazepin-2(3H)-one (4a) or (R)-3-isopropyl-1-methyl-5-phenyl-1H-benzo[e][1,4]diazepin-2(3H)-one (4b), respectively, and dppe = 1,2-bis(diphenylphosphino)ethane, dppf = 1,1'-bis(diphenylphosphino)ferrocene. The complexes were characterised in solution, by (1)H and (31)P NMR spectroscopy, and single crystals of complexes 6b and 7 were studied in the solid state by X-ray crystallography. The palladacycles were evaluated for in vitro activity as cytotoxic agents on A2780/S cells and also as cathepsin B inhibitors, an enzyme implicated in a number of cancer related events.

Triterpenoid saponins from the cytotoxic root extract of Sideroxylon foetidissimum, an endemic Yucatecan medicinal plant

The flora of the Yucatan peninsula (Mexico) includes approximately 3000 plant species. Sideroxylon foetidissimum Jacq. subsp. gaumeri (Sapotaceae) is an endemic plant to the Yucatan peninsula; its fruit is edible and local people use the plant for medicinal purposes, although no details on its preparation or application are available [1,2]. A preliminary cytotoxic evaluation of the ethanolic root extract of S. foetidissimum revealed a potent activity against murine macrophage like cell line RAW 264.7 (IC50=39.54±4.11µg/mL). The systematic bioassay-guided fractionation of the extract resulted in the identification of the active saponin-containing fraction (IC50=33.69±6.19µg/mL). Four new triterpenoid saponins and a 1:1 mixture of two saponins were isolated from the active saponin- containing fraction. The evaluation of their cytotoxic activity revealed no activity for the tested pure saponins; however, the 1:1 mixture of saponins showed a potent activity (IC50=11.91±1.49µg/mL). The isolation of the saponins was carried out using semi-preparative HPLC. The structural assignments of the pure saponins were based on 1D (1H and 13C and DEPT-135) and 2D (COSY, HMBC, HSQC and TOCSY) NMR and mass spectrometry analyses. In this presentation, the isolation, identification and cytotoxic activity of the isolated compounds is discussed in more detail.

Achiral, selective CCK2 receptor antagonists based on a 1,3,5-benzotriazepine-2,4-dione template

Novel, achiral 1H-1,3,5-benzotriazepine-2,4(3H,5H)-diones have been prepared and structurally characterized. These compounds are potent CCK2 receptor antagonists that display a high degree of selectivity over CCK1 receptors.

Aspects Of Microbial Heterotrophic Production In A Highly Turbid Estuary

The uptake of 14C glucose by natural microbial populations has been studied in the Severn Estuary and Bristol Channel, U.K.; the turbidity (suspended solids) in the estuary varied between < 5 mg · 1−1 at the seaward extremity to >800 mg · 1−1 in the estuary proper. The heterotrophic potential, Vm, was found to correlate with turbidity and particulate organic carbon but there was no correlation between microbial biomass, as assessed by plate counts, and turbidity or Vm; measurement of Vm ranged from 0.9 × 10−4 to 288 × 10−4μgC·1−1·h−1 and turnover time from <2 to >100 h. In 17 out of 42 experiments, the uptake of 14C glucose did not conform to Michaelis kinetics and in five of these experiments the data suggested that there may be a threshold of glucose concentration below which there is no uptake.

Effect Of Temperature On The Respiration Rate Of Meiofauna

The effect of temperature on respiration rate has been established, using Cartesian divers, for the meiofaunal sabellid polychaeteManayunkia aestuarina, the free-living nematodeSphaerolaimus hirsutus and the harpacticoid copepodTachidius discipes from a mudflat in the Lynher estuary, Cornwall, U.K. Over the temperature range normally experienced in the field, i.e. 5–20° C the size-compensated respiration rate (R c) was related to the temperature (T) in °C by the equation Log10 R c=-0.635+0.0339T forManayunkia, Log10 R c=0.180+0.0069T forSphaerolaimus and Log10 R c=-0.428+0.0337T forTachidius, being equivalent toQ 10 values of 2.19, 1.17 and 2.17 respectively. In order to derive the temperature response forManayunkia a relationship was first established between respiration rate and body size: Log10 R=0.05+0.75 Log10 V whereR=respiration in nl·O2·ind-1·h-1 andV=body volume in nl. TheQ 10 values are compared with values for other species derived from the literature. From these limited data a dichotomy emerges: species with aQ 10≏2 which apparently feed on diatoms and bacteria, the abundance of which are subject to large short term variability, and species withQ 10≏1 apparently dependent on more stable food sources.

The Unexpected Preference for the fac-Isomer with the Tris(5-ester-substituted-2,2′-bipyridine) Complexes of Ruthenium(II)

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Self-assembled triple helicates with preferential helicity

The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Antisense Bcl-2 Oligonucleotide Uptake in Human Transitional Cell Carcinoma.

Objectives; Antisense oligonucleotides (AO) downregulate Bcl-2 protein expression in various tumours if good target cell uptake is achieved. In this study, uptake of FITC labelled AO (FITC-AO) directed at Bcl-2 was examined in; (1) the RT4 bladder tumour cell line (2) normal pig urothelium and (3) human superficial bladder tumours. Methods; In the RT4 cell line, uptake of FITC-AO, FITC-scrambled and FITC-sense oligonucleotides were quantified by flow cytometry at 4h intervals over 24h. Uptake of FITC-AO was assessed in normal pig urothelium by flow cytometry after FITC-AO was infused for 1h. Uptake of FITC AO was assessed in samples from 14 human superficial bladder tumours which were maintained in an ex vivo model. In samples from 6 tumours, uptake at 4h was assessed using fluorescence microscopy. In samples from 8 separate tumours uptake every 4h within the first 24h incubation period was assessed by flow cytometry. Results; In the RT4 cell line the FITC-AO, FITC-scrambled and FITC-sense oligonucleotide uptake was similar. Disaggregated cells from the normal urothelium of the three pigs exhibited 33%, 46%, 51% of cells staining positively for FITC-AO as determined by flow cytometry. All 6 tumour samples had detectable intracellular FITC-AO by fluorescence microscopy at 4h. In the 8 tumours ,examined over the 24h incubation period, there was a range of percentages of positively staining cells. However, most tumours had a monotonic increase in intracellular fluorescence intensity that plateaued 16h post infusion. Conclusion; Antisense Bcl-2 oligonucleotides were readily taken up by superficial bladder cancer cells but the heterogenous uptake in tumour samples needs to be considered when assessing the bioavailability of these drugs.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Electrical activity induced by nitric oxide in canine colonic circular muscle.

Nitric oxide generates slow electrical oscillations (SEOs) in cells near the myenteric edge of the circular muscle layer, which resemble slow waves generated by interstitial cells of Cajal (ICCs) at the submucosal edge of this muscle. The properties of SEOs were studied to determine whether these events are similar to slow waves. Rapid frequency membrane potential oscillations (MPOs; 16 +/- 1 cycles/min and 9.6 +/- 0.2 mV) were recorded from control muscles near the myenteric edge. Sodium nitroprusside (0.3 microM) reduced MPOs and initiated SEOs (1.3 +/- 0.3 cycles/min and 13.4 +/- 1.4 mV amplitude). SEOs were abolished by the guanylate cyclase inhibitor 1H-[1,2,4]-oxadiazolo-[4,3-a]-quinoxaline-1-one (10 microM). MPOs were abolished by nifedipine (1 microM), whereas SEO frequency increased and the amount of depolarization decreased. BAY K 8644 (1 microM) prolonged SEOs and reduced their frequency. SEOs were abolished by Ni(2+) (0.5 mM), low Ca(2+) solution (0.1 mM Ca(2+)), cyclopiazonic acid (10 microM), and the mitochondrial uncouplers antimycin (10 microM) and carbonyl cyanide p-trifluoromethoxyphenylhydrazone (1 microM). Oligomycin (10 microM) was without effect. These effects are similar to those described for colonic slow waves. Our results suggest that nitric oxide-induced SEOs are similar in mechanism to slow waves, an activity not previously thought to be generated by myenteric pacemakers.

Potential and kinetic sputtering of alkanethiol self-assembled monolayers by impact of highly charged ions

Highly charged ions have been used to study the sputtering of positive molecular fragments from mercaptoundecanoic acid and dodecanethiol self-assembled monolayers on gold surfaces. The samples were bombarded with Arq+ (42n⁺, and Cn+1O2H_{2n + 1}⁺ from mercaptoundecanoic and H+, CnH_2n⁺, and Cn+1H_{2n + 3}⁺ from dodecanethiol. The proton yields were increased with larger charge state q of the highly charged ion (HCI) in both samples, scaling as qgamma, with gamma~5. The charge state dependence is discussed in terms of electron transfer to the HCI. The final yield of protons depends on molecular functional group characteristics, orientation on the surface, and reneutralization phenomena.

Partial agonism, neutral antagonism, and inverse agonism at the human wild-type and constitutively active cholecystokinin-2 receptors

Cholecystokinin receptor-2 (CCK2R) is a G protein receptor that regulates a number of physiological functions. Activation of CCK2R and/or expression of a constitutively active CCK2R variant may contribute to human diseases, including digestive cancers. Search for antagonists of the CCK2R has been an important challenge during the last few years, leading to discovery of a set of chemically distinct compounds. However, several early-discovered antagonists turned out to be partial agonists. In this context, we carried out pharmacological characterization of six CCK2R antagonists using COS-7 cells expressing the human CCK2R or a CCK2R mutant having a robust constitutive activity on inositol phosphates production, and we investigated the molecular mechanisms which, at a CCK2R binding site, account for these features. Results indicated that three compounds, 3R(+)-N-(2,3-dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3- yl)-N'-(3-methylphenyl)urea (L365,260), 4-{[2-[[3-(lH-indol-3-yl)-2- methyl-1-oxo-2-[[[1.7.7-trimethyl-bicyclo[2.2.1]hept-2-yl)-oxy]carbonyl]amino] propyl]amino]-1-phenylethyl]amino-4-oxo-[lS-la.2[S*(S*)]4a]} -butanoate N-methyl-D-glucamine (PD135, 158), and (R)-1-naphthalenepropanoic acid, b-[2-[[2-(8-azaspiro-[4.5]dec-8-ylcarbonyl)-4,6-dimethylphenyl]amino]-2- oxoethyl] (CR2945), were partial agonists; one molecule, 1-[(R)-2,3-dihydro-1- (2,3-dihydro-1-(2-methylphenacyl)-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl] -3-(3-methylphenyl)urea (YM022), was a neutral antagonist; and two compounds, N-(+)-[1-(adamant-1-ylmethyl)-2,4-dioxo-5-phenyl2,3,4,5-tetrahydro-1H-1, 5-benzodiazepin-3-yl]-N'-phenylurea (GV150,013X) and ([(N-[methoxy-3 phenyl] N-[N-methyl N-phenyl carbamoylmethyl], carbomoylmethyl)-3 ureido]-3-phenyl)2-propionic acid (RPR101,048), were inverse agonists. Furthermore, target- and pharmacophore-based docking of ligands followed by molecular dynamic simulation experiments resulted in consistent motion of aromatic residues belonging to a network presumably important for activation, thus providing the first structural explanations for the different pharmacological profiles of tested compounds. This study confirms that several referenced so-called antagonists are in fact partial agonists, and because of this undesired activity, we suggest that newly generated molecules should be preferred to efficiently block CCK2R-related physiological effects. Furthermore, data on the structural basis for the different pharmacological features of CCK2R ligands will serve to further clarify CCK2R mechanism of activation. Copyright © 2006 The American Society for Pharmacology and Experimental Therapeutics.

Discovery of substituted maleimides as liver X receptor agonists and determination of a ligand-bound crystal structure

Substituted 3-(phenylamino)-1H-pyrrole-2,5-diones were identified from a high throughput screen as inducers of human ATP binding cassette transporter A1 expression. Mechanism of action studies led to the identification of GSK3987 (4) as an LXR ligand. 4 recruits the steroid receptor coactivator-1 to human LXR alpha and LXRP with EC(50)s of 40 nM, profiles as an LXR agonist in functional assays, and activates LXR though a mechanism that is similar to first generation LXR agonists.