939 resultados para gene regulatory network


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Bacillus anthracis toxin genes, cya, lef , and pag, can be viewed as a regulon, in which transcription of all three genes is activated in trans by the same regulatory gene, atxA, in response to the same signal, CO2. I determined that several phenotypes are associated with the atxA gene. In addition to being toxin-deficient, an atxA -null mutant grows poorly on minimal media and sporulates early compared to the parent strain. Furthermore, an atxA-null mutant has an altered 2-D gel protein profile. I used a genetic approach to find additional atxA-regulated genes. Random transcriptional lacZ fusions were generated in B. anthracis using transposon Tn 917-LTV3. Transposon-insertion libraries were screened for mutants expressing increased β-galactosidase activity in 5% CO2. Introduction of an atxA-null mutation in these mutants revealed that 79% of the CO2-regulated fusions were also atxA-dependent. DNA sequence analysis of transposon insertion sites in mutants carrying CO 2/atxA-regulated fusions revealed ten mutants harboring transposon insertions in loci distinct from the toxin genes. The majority of the tcr (toxin co-regulated) loci mapped within the pXO1 pathogenicity island. These results indicate a clear association of atxA with CO2-enhanced gene expression in B. anthracis and provide evidence that atxA regulates genes other than the structural genes for the anthrax toxin proteins. ^ Characterization of one tcr locus revealed a new regulatory gene, pagR. The pagR gene (300 nt) is located downstream of pag. pagR is cotranscribed with pag and is responsible for autogenous control of the operon. pagR also represses expression of cya and lef. Repression of toxin gene expression by pagR may be mediated by atxA. The steady state level of atxA mRNA is increased in a pagR mutant. Recombinant PagR protein purified from Escherichia coli did not specifically bind the promoter regions of pagA or atxA. An unidentified factor in B. anthracis crude extracts, however, was able to bind the atxA promoter in the absence of PagR or AtxA. These investigations increase our knowledge of virulence regulation in B. anthracis and ultimately will lead to a better understanding of anthrax disease. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis is centered on applying molecular genetics to study pattern formation during animal development. More specifically, this thesis describes the functional studies of a LIM-homeodomain gene called lmx1b during murine embryogenesis. Lmx1b expression is restricted to the mid-hindbrain junction as well as to the dorsal mesenchyme of the limb, suggesting important functions during mid-hindbrain and limb development. To test these possibilities, lmx1b homozygous mutant mice were generated and their limb and CNS phenotypes examined. Lmx1b homozygous mutant mice exhibit a large reduction of mid-hindbrain structures, and that their limbs are symmetrical along the dorsal-ventral axis as the result of a dorsal to ventral transformation. Taken together, these studies define essential functions for lmx1b in mid-hindbrain patteming and in dorsal limb cell fate determination. However, the molecular mechanisms which accounts for these phenotypes are unknown, and whether lmx1b has same or distinctive functions during the mid-hindbrain and limb development is also unclear. ^ Recently, insight into molecular mechanisms of mid-hindbrain patterning and limb development has resulted from the identification of several factors with restricted expression patterns within these regions. These include the secreted factors wnt-1, fgf-8, wnt-7a and the transcription factors pax-2, and en-1. Targeted disruption of any of these genes in mice suggests that these genes might be involved in similar regulatory pathways. Analysis of the expression of these genes in lmx1b mutants demonstrates that lmxlb is not required for the initiation, but is required to maintain their expression at the mid-hindbrain junction. Thus, lmxlb is not required for specifying mid-hindbrain cell fates, rather, it functions to ensure the establishment or maintenance of a proper organizing center at the mid-hindbrain junction. Interestingly, lmxlb functions cell non-autonomously in chimera analysis, which indicates that lmx1b might regulate the expression of secreted factors such as wnt-1 and/or fgf-8 in the organizing center. In contrast, lmx1b functions cell autonomously in the dorsal limb to govern dorsal ventral limb development and its expression is regulated by with wnt-7a and en-1. However, single and double mutant analysis suggest that all three genes have partially overlapping functions as well as independent functions. The results point toward a complicated network of cross-talks among all three limb axes. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The human glutathione S-transferase P1 (GSTP1) protein is an endogenous inhibitor of c-jun N-terminal kinases (JNKs) and an important phase II detoxification enzyme. ^ Recent identification of a cAMP response element (CRE) in the 5 ′-region of the human GSTP1 gene and several putative phosphorylation sites for the Ser/Thr protein kinases, including, cAMP-dependent protein kinases (PKAs), protein kinases C (PKCs), and JNKs in the GSTP1 protein raised the possibility that signaling pathways may play an important role in the transcriptional and post-translational regulation of GSTP1 gene. This study examined (a) whether the signaling pathway mediated by CAMP, via the GSTP1 CRE, is involved in the transcriptional regulation of the GSTP1 gene, (b) whether signaling pathways mediated by the Ser/Thr protein kinases (PKAs, PKCs, and JNKs) induce post-translational modification, viz. phosphorylation of the GSTP1 protein, and (c) whether such phosphorylation of the GSTP1 protein alters its functions in metabolism and in JNK signaling. ^ The first major finding in this study is the establishment of the human GSTP1 gene as a novel CAMP responsive gene in which transcription is activated via an interaction between PKA activated CRE binding protein-1 (CREB-1) and the CRE in the 5′-regulatory region. ^ The second major finding in this study is the observation that the GSTP1 protein undergoes phosphorylation and functionally activated by second messenger-activated protein kinases, PKA and PKC, in tumor cells with activated signaling pathways. Following phosphorylation by PKA or PKC, the catalytic activity of the GSTP1 protein was significantly enhanced, as indicated by a decrease in its Km (2- to 3.6-fold) and an increase in Kcat/ Km (1.6- to 2.5-fold) for glutathione. Given the frequent over-expression of GSTP1 and the aberrant PKA/PKC signaling cascade observed in tumors, these findings suggest that phosphorylation of GSTP1 may contribute to the malignant progression and drug-resistant phenotype of these tumors. ^ The third major finding in this study is that the GSTP1 protein, an inhibitor of JNKs, undergoes significant phosphorylation in tumor cells with activated JNK signaling pathway and in those under oxidative stress. Following phosphorylation by JNK, the ability of GSTP1 to inhibit JNK downstream function, i.e. c-jun phosphorylation, was significantly enhanced, suggesting a feedback mechanism of regulation of JNK-mediated cellular signaling. (Abstract shortened by UMI.) ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cardiovascular disease (CVD) is the leading cause of death in the United States. One manifestation of CVD known to increase mortality is an enlarged, or hypertrophic heart. Hypertrophic cardiomyocytes adapt to increased contractile demand at the genetic level with a re-emergence of the fetal gene program and a downregulation of fatty acid oxidation genes with concomitant increased reliance on glucose-based metabolism. To understand the transcriptional regulatory pathways that implement hypertrophic directives we analyzed the upstream promoter region of the muscle specific isoform of the nuclear-encoded mitochondrial gene, carnitine palmitoyltransferase-1β (CPT-1β) in cultured rat neonatal cardiac myocytes. This enzyme catalyzes the rate-limiting step of fatty acid entry into β-oxidation and is downregulated in cardiac hypertrophy and failure, making it an attractive model for the study of hypertrophic gene regulation and metabolic adaptations. We demonstrate that the muscle-enriched transcription factors GATA-4 and SRF synergistically activate CPT-1β; moreover, DNA binding to cognate sites and intact protein structure are required. This mechanism coordinates upregulation of energy generating processes with activation of the energy consuming contractile promoter for cardiac α-actin. We hypothesized that fatty acid or glucose responsive transcription factors may also regulate CPT-1β. Oleate weakly stimulates CPT-1β activity; in contrast, the glucose responsive Upstream Stimulatory Factors (USF) dramatically depresses the CPT-1β reporter. USF regulates CPT-1β through a novel physical interaction with the cofactor PGC-1 and abrogation of MEF2A/PGC-1 synergistic stimulation. In this way, USF can inversely regulate metabolic gene programs and may play a role in the shift of metabolic substrate preference seen in hypertrophy. Failing hearts have elevated expression of the nuclear hormone receptor COUP-TF. We report that COUP-TF significantly suppresses reporter transcription independent of DNA binding and specific interactions with GATA-4, Nkx2.5 or USF. In summary, CPT-1β transcriptional regulation integrates mitochondrial gene expression with two essential cardiac functions: contraction and metabolic substrate oxidation. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molecular events involved in specification of early hematopoietic system are not well known. In Xenopus, a paired-box homeodomain family (Mix.1–4) has been implicated in this process. Although Mix-like homeobox genes have been isolated from zebrafish (bon), chicken (CMIX) and mice (MmI/MIXL1), isolation of a human Mix-like gene has remained elusive. ^ We have recently isolated and characterized a novel human Mix-like homeobox gene with a predicted open reading frame of 232 amino acids designated the Mix.1 homeobox (Xenopus laevis)-like gene (MIXL). The overall identity of this novel protein to CMIX and MmI/MIXL1 is 41% and 69%, respectively. However, the identity in the homeodomain is 66% to that of Xenopus Mix.1, 79% to that of CMIX, and 94% to that of MmI/MIXL1. In normal hematopoiesis, MIXL expression appears to be restricted immature B and T lymphoid cells. Several acute leukemic cell lines of B, T and myeloid lineages express MIXL suggesting a survival/block in differentiation advantage. Furthermore, Xenopus animal cap assay revealed that MIXL could induce expression of the α-globin gene, suggesting a functional conservation of the homeodomain. ^ Biochemical analysis revealed that MIXL proteins are phosphorylated at multiple sites. Immunoprecipitation and immunoblotting confirmed that MIXL is tyrosine phosphorylated. Mutational analysis determined that Tyr20 appears to be the site for phosphorylation. However, deletion analysis preliminarily showed that the proline-rich domain appears not to be necessary for tyrosine phosphorylation. The novel finding will help us make a deeper understanding of the regulation on homeodomain proteins by rarely reported tyrosine phosphorylation. ^ Taken together, isolation of the MIXL gene is the first step toward understanding novel regulatory circuits in early hematopoietic differentiation and malignant transformation. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coccolithophores are unicellular marine algae that produce biogenic calcite scales and substantially contribute to marine primary production and carbon export to the deep ocean. Ongoing ocean acidification particularly impairs calcifying organisms, mostly resulting in decreased growth and calcification. Recent studies revealed that the immediate physiological response in the coccolithophore Emiliania huxleyi to ocean acidification may be partially compensated by evolutionary adaptation, yet the underlying molecular mechanisms are currently unknown. Here, we report on the expression levels of 10 candidate genes putatively relevant to pH regulation, carbon transport, calcification and photosynthesis in E. huxleyi populations short-term exposed to ocean acidification conditions after acclimation (physiological response) and after 500 generations of high CO2 adaptation (adaptive response). The physiological response revealed downregulation of candidate genes, well reflecting the concomitant decrease of growth and calcification. In the adaptive response, putative pH regulation and carbon transport genes were up-regulated, matching partial restoration of growth and calcification in high CO2-adapted populations. Adaptation to ocean acidification in E. huxleyi likely involved improved cellular pH regulation, presumably indirectly affecting calcification. Adaptive evolution may thus have the potential to partially restore cellular pH regulatory capacity and thereby mitigate adverse effects of ocean acidification.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Learning the structure of a graphical model from data is a common task in a wide range of practical applications. In this paper, we focus on Gaussian Bayesian networks, i.e., on continuous data and directed acyclic graphs with a joint probability density of all variables given by a Gaussian. We propose to work in an equivalence class search space, specifically using the k-greedy equivalence search algorithm. This, combined with regularization techniques to guide the structure search, can learn sparse networks close to the one that generated the data. We provide results on some synthetic networks and on modeling the gene network of the two biological pathways regulating the biosynthesis of isoprenoids for the Arabidopsis thaliana plant

Relevância:

30.00% 30.00%

Publicador:

Resumo:

During seed germination, the endosperm cell walls (CWs) suffer an important weakening process mainly driven by hydrolytic enzymes, such are endo-?- mannanases (MAN; EC. 3.2.1.78) that catalyze the cleavage of ?1?4 bonds in the mannan-polymers. In Arabidopsis thaliana seeds, endo-?-mannanase activity increases during seed imbibition, decreasing after radicle emergence1. AtMAN7 is the most highly expressed MAN gene in seeds upon germination and their transcripts are restricted to the micropylar endosperm and to the radicle tip just before radicle emergence. Mutants with a T-DNA insertion in this gene (K.O. MAN7) have a slower germination rate than the wild type (t50=34 h versus t50=25 h). To gain insight into the transcriptional regulation of the AtMAN7 gene, a bioinformatic search for conserved non-coding cis-elements (phylogenetic shadowing) within the Brassicaceae orthologous MAN7 gene promoters has been done and these conserved motives have been used as baits to look for their interacting transcription factors (TFs), using as a prey an arrayed yeast library of circa 1,200 TFs from A. thaliana. The basic leucine zipper AtbZIP44, but not its closely related ortholog AtbZIP11, has been thus identified and its regulatory function upon AtMAN7 during seed germination validated by different molecular and physiological techniques, such are RT-qPCR analyses, mRNA Fluorescence in situ Hybridization (FISH) experiments, and by the establishment of the germination kinetics of both over-expression (oex) lines and TDNA insertion mutants in AtbZIP44. The transcriptional combinatorial network through which AtbZIP44 regulates AtMAN7 gene expression during seed germination has been further explored through protein-protein interactions between AtbZIP44 and other bZIP members. In such a way, AtbZIP9 has been identified by yeast two-hybrid experiments and its physiological implication in the control of AtMAN7 expression similarly established.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

La semilla es el órgano que garantiza la propagación y continuidad evolutiva de las plantas espermatofitas y constituye un elemento indispensable en la alimentación humana y animal. La semilla de cereales acumula en el endospermo durante la maduración, mayoritariamente, almidón y proteínas de reserva. Estas reservas son hidrolizadas en la germinación por hidrolasas sintetizadas en la aleurona en respuesta a giberelinas (GA), siendo la principal fuente de energía hasta que la plántula emergente es fotosintéticamente activa. Ambas fases del desarrollo de la semilla, están reguladas por una red de factores de transcripción (TF) que unen motivos conservados en cis- en los promotores de sus genes diana. Los TFs son proteínas que han desempeñado un papel central en la evolución y en el proceso de domesticación, siendo uno de los principales mecanismos de regulación génica; en torno al 7% de los genes de plantas codifican TFs. Atendiendo al motivo de unión a DNA, éstos, se han clasificado en familias. La familia DOF (DNA binding with One Finger) participa en procesos vitales exclusivos de plantas superiores y sus ancestros cercanos (algas, musgos y helechos). En las semillas de las Triticeae (subfamilia Pooideae), se han identificado varias proteínas DOF que desempeñan un papel fundamental en la regulación de la expresión génica. Brachypodium distachyon es la primera especie de la subfamilia Pooideae cuyo genoma (272 Mbp) ha sido secuenciado. Su pequeño tamaño, ciclo de vida corto, y la posibilidad de ser transformado por Agrobacterium tumefaciens (plásmido Ti), hacen que sea el sistema modelo para el estudio de cereales de la tribu Triticeae con gran importancia agronómica mundial, como son el trigo y la cebada. En este trabajo, se han identificado 27 genes Dof en el genoma de B. distachyon y se han establecido las relaciones evolutivas entre estos genes Dof y los de cebada (subfamilia Pooideae) y de arroz (subfamilia Oryzoideae), construyendo un árbol filogenético en base al alineamiento múltiple del dominio DOF. La cebada contiene 26 genes Dof y en arroz se han anotado 30. El análisis filogenético establece cuatro grupos de genes ortólogos (MCOGs: Major Clusters of Orthologous Genes), que están validados por motivos conservados adicionales, además del dominio DOF, entre las secuencias de las proteínas de un mismo MCOG. El estudio global de expresión en diferentes órganos establece un grupo de nueve genes BdDof expresados abundantemente y/o preferencialmente en semillas. El estudio detallado de expresión de estos genes durante la maduración y germinación muestra que BdDof24, ortólogo putativo a BPBF-HvDOF24 de cebada, es el gen más abundante en las semillas en germinación de B. distachyon. La regulación transcripcional de los genes que codifican hidrolasas en la aleurona de las semillas de cereales durante la post‐germinación ha puesto de manifiesto la existencia en sus promotores de un motivo tripartito en cis- conservado GARC (GA-Responsive Complex), que unen TFs de la clase MYB-R2R3, DOF y MYBR1-SHAQKYF. En esta tesis, se ha caracterizado el gen BdCathB de Brachypodium que codifica una proteasa tipo catepsina B y es ortólogo a los genes Al21 de trigo y HvCathB de cebada, así como los TFs responsables de su regulación transcripcional BdDOF24 y BdGAMYB (ortólogo a HvGAMYB). El análisis in silico del promotor BdCathB ha identificado un motivo GARC conservado, en posición y secuencia, con sus ortólogos en trigo y cebada. La expresión de BdCathB se induce durante la germinación, así como la de los genes BdDof24 y BdGamyb. Además, los TFs BdDOF24 y BdGAMYB interaccionan en el sistema de dos híbridos de levadura e in planta en experimentos de complementación bimolecular fluorescente. En capas de aleurona de cebada, BdGAMYB activa el promotor BdCathB, mientras que BdDOF24 lo reprime; este resultado es similar al obtenido con los TFs ortólogos de cebada BPBF-HvDOF24 y HvGAMYB. Sin embargo, cuando las células de aleurona se transforman simultáneamente con los dos TFs, BdDOF24 tiene un efecto aditivo sobre la trans-activación mediada por BdGAMYB, mientras que su ortólogo BPBF-HvDOF24 produce el efecto contrario, revirtiendo el efecto de HvGAMYB sobre el promotor BdCathB. Las diferencias entre las secuencias deducidas de las proteínas BdDOF24 y BPBF-HvDOF24 podrían explicar las funciones opuestas que desempeñan en su interacción con GAMYB. Resultados preliminares con líneas de inserción de T-DNA y de sobre-expresión estable de BdGamyb, apoyan los resultados obtenidos en expresión transitoria. Además las líneas homocigotas knock-out para el gen BdGamyb presentan alteraciones en anteras y polen y no producen semillas viables. ABSTRACT The seed is the plant organ of the spermatophytes responsible for the dispersion and survival in the course of evolution. In addition, it constitutes one of the most importan elements of human food and animal feed. The main reserves accumulated in the endosperm of cereal seeds through the maturation phase of development are starch and proteins. Its degradation by hydrolases synthetized in aleurone cells in response to GA upon germination provides energy, carbon and nitrogen to the emerging seedling before it acquires complete photosynthetic capacity. Both phases of seed development are controlled by a network of transcription factors (TFs) that interact with specific cis- elements in the promoters of their target genes. TFs are proteins that have played a central role during evolution and domestication, being one of the most important regulatory mechanisms of gene expression. Around 7% of genes in plant genomes encode TFs. Based on the DNA binding motif, TFs are classified into families. The DOF (DNA binding with One Finger) family is involved in specific processes of plants and its ancestors (algae, mosses and ferns). Several DOF proteins have been described to play important roles in the regulation of genes in seeds of the Triticeae tribe (Pooideae subfamily). Brachypodium distachyon is the first member of the Pooideae subfamily to be sequenced. Its small size and compact structured genome (272 Mbp), the short life cycle, small plant size and the possibility of being transformed with Agrobacterium tumefaciens (Ti-plasmid) make Brachypodium the model system for comparative studies within cereals of the Triticeae tribe that have big economic value such as wheat and barley. In this study, 27 Dof genes have been identified in the genome of B. distachyon and the evolutionary relationships among these Dof genes and those frome barley (Pooideae subfamily) and those from rice (Oryzoideae subfamily) have been established by building a phylogenetic tree based on the multiple alignment of the DOF DNA binding domains. The barley genome (Hordeum vulgare) contains 26 Dof genes and in rice (Oryza sativa) 30 genes have been annotated. The phylogenetic analysis establishes four Major Clusters of Orthologous Genes (MCOGs) that are supported by additional conserved motives out of the DOF domain, between proteins of the same MCOG. The global expression study of BdDof genes in different organs and tissues classifies BdDof genes into two groups; nine of the 27 BdDof genes are abundantly or preferentially expressed in seeds. A more detailed expression analysis of these genes during seed maturation and germination shows that BdDof24, orholog to barley BPBF-HvDof24, is the most abundantly expressed gene in germinating seeds. Transcriptional regulation studies of genes that encode hydrolases in aleurone cells during post-germination of cereal seeds, have identified in their promoters a tripartite conserved cis- motif GARC (GA-Responsive Complex) that binds TFs of the MYB-R2R3, DOF and MYBR1-SHAQKYF families. In this thesis, the characterization of the BdCathB gene, encoding a Cathepsin B-like protease and that is ortholog to the wheat Al21 and the barley HvCathB genes, has been done and its transcriptional regulation by the TFs BdDOF24 and BdGAMYB (ortholog to HvGAMYB) studied. The in silico analysis of the BdCathB promoter sequence has identified a GARC motif. BdCathB expression is induced upon germination, as well as, those of BdDof24 and BdGamyb genes. Moreover, BdDOF24 and BdGAMYB interact in yeast (Yeast 2 Hybrid System, Y2HS) and in planta (Bimolecular Fluorecence Complementation, BiFC). In transient assays in aleurone cells, BdGAMYB activates the BdCathB promoter, whereas BdDOF24 is a transcriptional repressor, this result is similar to that obtained with the barley orthologous genes BPBF-HvDOF24 and HvGAMYB. However, when aleurone cells are simultaneously transformed with both TFs, BdDOF24 has an additive effect to the trans-activation mediated by BdGAMYB, while its ortholog BPBF-HvDOF24 produces an opposite effect by reducing the HvGAMYB activation of the BdCathB promoter. The differences among the deduced protein sequences between BdDOF24 and BPBF-HvDOF24 could explain their opposite functions in the interaction with GAMYB protein. Preliminary results of T-DNA insertion (K.O.) and stable over-expression lines of BdGamyb support the data obtained in transient expression assays. In addition, the BdGamyb homozygous T-DNA insertion (K.O.) lines have anther and pollen alterations and they do not produce viable seeds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Molybdenum-nitrogenase is responsible for most biological nitrogen fixation activity (BNF) in the biosphere. Due to its great agronomical importance, it has been the subject of profound genetic and biochemical studies. The Mo nitrogenase carries at its active site a unique iron-molybdenum cofactor (FeMoco) that consists of an inorganic 7 Fe, 1 Mo, 1 C, 9 S core coordinated to the organic acid homocitrate. Biosynthesis of FeMo-co occurs outside nitrogenase through a complex and highly regulated pathway involving proteins acting as molecular scaffolds, metallocluster carriers or enzymes that provide substrates in appropriate chemical forms. Specific expression regulatory factors tightly control the accumulation levels of all these other components. Insertion of FeMo-co into a P-cluster containing apo-NifDK polypeptide results in nitrogenase reconstitution. Investigation of FeMo-co biosynthesis has uncovered new radical chemistry reactions and new roles for Fe-S clusters in biology.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Resulta interesante comprender como microorganismos sencillos como la bacteria Escherichia coli poseen mecanismos no tan simples para responder al entorno en el que está gestionada por complicadas redes de regulación formadas por genes y proteínas, donde cada elemento de la red genética debe tomar parte en armonía, en el momento justo y la cantidad adecuada para dar lugar a la respuesta celular apropiada. La biología sintética es un nuevo área de la biología y la tecnología que fusiona la biolog ía molecular, la ingeniería genética y las herramientas computacionales, para crear sistemas biológicos con funcionalidades novedosas. Los sistemas creados sintéticamente son ya una realidad, y cada vez se acumulan más trabajos alrededor del mundo que muestran su factibilidad. En este campo no solo se hacen pequeñas modificaciones en la información genética, sino que también se diseñan, manipulan e introducen circuitos genéticos a los organismos. Actualmente, se hace un gran esfuerzo para construir circuitos genéticos formados por numerosos genes y caracterizar la interacción de los mismos con otras moléculas, su regulaci ón, expresión y funcionalidad en diferentes organismos. La mayoría de los proyectos de biología sintética que se han desarrollado hasta ahora, se basan en el conocimiento actual del funcionamiento de los organismos vivos. Sin embargo, la información es numerosa y creciente, por lo que se requiere de herramientas computacionales y matem áticas para integrar y hacer manejable esta gran cantidad de información. El simulador de colonias bacterianas GRO posee la capacidad de representar las dinámicas más simples del comportamiento celular, tales como crecimiento, división y comunicación intercelular mediante conjugación, pero carece de la capacidad de simular el comportamiento de la colonia en presencia de un circuito genético. Para ello, se ha creado un nuevo módulo de regulación genética que maneja las interaciones entre genes y proteínas de cada célula ejecutando respuestas celulares específicas. Dado que en la mayoría de los experimentos intervienen colonias del orden de 105 individuos, es necesario un módulo de regulación genética simplificado que permita representar de la forma más precisa posible este proceso en colonias de tales magnitudes. El módulo genético integrado en GRO se basa en una red booleana, en la que un gen puede transitar entre dos estados, on (expresado) o off (reprimido), y cuya transición viene dada por una serie de reglas lógicas.---ABSTRACT---It is interesting to understand how simple organisms such as Escherichia coli do not have simple mechanisms to respond to the environment in which they find themselves. This response is managed by complicated regulatory networks formed by genes and proteins, where each element of the genetic network should take part in harmony, at the right time and with the right amount to give rise to the appropriate cellular response. Synthetic biology is a new area of biology and technology that combines molecular biology, genetic engineering and computational tools to create biological systems with novel features. The synthetically created systems are already a reality, and increasingly accumulate work around the world showing their feasibility. In this field not only minor changes are made in the genetic information but also genetic circuits designed, manipulated and introduced into the organisms. Currently, it takes great effort to build genetic circuits formed by numerous genes and characterize their interaction with other molecules, their regulation, their expression and their function in different organisms. Most synthetic biology projects that have been developed so far are based on the current knowledge of the functioning of living organisms. However, there is a lot of information and it keeps accumulating, so it requires computational and mathematical tools to integrate and manage this wealth of information. The bacterial colonies simulator, GRO, has the ability to represent the simplest dynamics of cell behavior, such as growth, division and intercellular communication by conjugation, but lacks the ability to simulate the behavior of the colony in the presence of a genetic circuit. To this end, a new genetic regulation module that handles interactions between genes and proteins for each cell running specific cellular responses has been created. Since most experiments involve colonies of about 105 individuals, a simplified genetic module which represent cell dynamics as accurately and simply as possible is needed. The integrated genetic GRO module is based on a Boolean network, in which a gene can be in either of two states, on (expressed) or off (repressed), and whose transition is given by a set of logical rules.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

cAMP, through the activation of cAMP-dependent protein kinase (PKA), is involved in transcriptional regulation. In eukaryotic cells, cAMP is not considered to alter the binding affinity of CREB/ATF to cAMP-responsive element (CRE) but to induce serine phosphorylation and consequent increase in transcriptional activity. In contrast, in prokaryotic cells, cAMP enhances the DNA binding of the catabolite repressor protein to regulate the transcription of several operons. The structural similarity of the cAMP binding sites in catabolite repressor protein and regulatory subunit of PKA type II (RII) suggested the possibility of a similar role for RII in eukaryotic gene regulation. Herein we report that RIIβ subunit of PKA is a transcription factor capable of interacting physically and functionally with a CRE. In contrast to CREB/ATF, the binding of RIIβ to a CRE was enhanced by cAMP, and in addition, RIIβ exhibited transcriptional activity as a Gal4-RIIβ fusion protein. These experiments identify RIIβ as a component of an alternative pathway for regulation of CRE-directed transcription in eukaryotic cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Developmental commitment involves activation of lineage-specific genes, stabilization of a lineage-specific gene expression program, and permanent inhibition of inappropriate characteristics. To determine how these processes are coordinated in early T cell development, the expression of T and B lineage-specific genes was assessed in staged subsets of immature thymocytes. T lineage characteristics are acquired sequentially, with germ-line T cell antigen receptor-β transcripts detected very early, followed by CD3ɛ and terminal deoxynucleotidyl transferase, then pTα, and finally RAG1. Only RAG1 expression coincides with commitment. Thus, much T lineage gene expression precedes commitment and does not depend on it. Early in the course of commitment to the T lineage, thymocytes lose the ability to develop into B cells. To understand how this occurs, we also examined expression of well defined B lineage-specific genes. Although λ5 and Ig-α are not expressed, the μ0 and Iμ transcripts from the unrearranged IgH locus are expressed early, in distinct patterns, then repressed just before RAG1 expression. By contrast, RNA encoding the B cell receptor component Ig-β was found to be transcribed in all immature thymocyte subpopulations and throughout most thymocyte differentiation. Ig-β expression is down-regulated only during positive selection of CD4+CD8– cells. Thus several key participants in the B cell developmental program are expressed in non-B lineage-committed cells, and one is maintained even through commitment to an alternative lineage, and repressed only after extensive T lineage differentiation. The results show that transcriptional activation of “lymphocyte-specific” genes can occur in uncommitted precursors, and that T lineage commitment is a composite of distinct positive and negative regulatory events.