1000 resultados para an artel


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: Achalasia of the esophagus is characterized by aperistalsis and incomplete relaxation of the lower esophageal sphincter in response to swallowing. The objective of the present study is to present the experience of a modified Heller myotomy via a laparoscopic approach for the treatment of children who had this condition. Methods: A retrospective review of medical records of all patients who underwent this procedure from 2000 to 2009 was performed. The procedure consisted of an extended esophagomyotomy beginning on the lower part of the lower esophageal sphincter and continuing 5 to 6 cm above on the lower third of the esophagus, and then extended 3 to 4 cm below to the stomach, associated with an anterior 180-degree hemi-fundoplication according to Dor`s technique. Results: Fifteen patients were included in the study. There were 8 female and 7 male patients. Mean operating time was 190 minutes with no intraoperative complications and 1 conversion to open surgery because of difficulty in dissecting an inflamed distal esophagus. In a mean follow-up period of 32.3 months, 2 patients had recurrence of mild dysphagia that disappeared spontaneously, and 1 required a single botulinum toxin injection with complete resolution of symptoms. Conclusion: We conclude that the laparoscopic extended Heller myotomy with Dor fundoplication is a safe and effective method for the treatment for achalasia in the pediatric population even in advanced cases. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Brain injury is responsible for significant morbidity and mortality in trauma patients, but controversy still exists over optimal fluid management for these patients. This study aimed to investigate the effects of acute hemodilution with hydroxyethyl starch (HES) or lactated Ringer`s solution (LR) in intracranial pressure (ICP) and cerebral perfusion pressure (CPP) in dogs submitted to a cryogenic brain injury model. Methods: Design-Prospective laboratory animal study. Setting-Research laboratory in a teaching hospital. Subjects-Thirty-five male mongrel dogs. Interventions-Animals were enrolled to five groups: control, hemodilution with LR or HES 6% to an hematocrit target of 27% or 35%. Results: ICP and CPP levels were measured after cryogenic brain injury. Hemodilution promotes an increment of ICP levels, which decreases CPP when hematocrit target was estimated in 27.% after hemodilution. However, no differences were observed regarding crystalloid or colloid solution used for hemodilution in ICP and CPP levels. Conclusions: Hemodilution to a low hematocrit level increases ICP and decreases CPP scores in dogs submitted to a cryogenic brain injury. These results suggest that excessive hemodilution to a hematocrit below 30% should be avoided in traumatic brain injury patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: The diagnosis of prostate cancer in men with persistently increased prostate specific antigen after a negative prostate biopsy has become a great challenge for urologists and pathologists. We analyzed the diagnostic value of 6 genes in the tissue of patients with prostate cancer. Materials and Methods: The study was comprised of 50 patients with localized disease who underwent radical prostatectomy. Gene selection was based on a previous microarray analysis. Among 4,147 genes with different expressions between 2 pools of patients 6 genes (PSMA, TMEFF2, GREB1, TH1L, IgH3 and PGC) were selected. These genes were tested for diagnostic value using the quantitative reverse transcription polymerase chain reaction method. Initially malignant tissue samples from 33 patients were analyzed and in the second part of the study we analyzed benign tissue samples from the other 17 patients with prostate cancer. The control group was comprised of tissue samples of patients with benign prostatic hyperplasia. Results: Analysis of malignant prostatic tissue demonstrated that prostate specific membrane antigen was over expressed (mean 9 times) and pepsinogen C was under expressed (mean 1.3 X 10(-4) times) in all cases compared to benign prostatic hyperplasia. The other 4 tested genes showed a variable expression pattern not allowing for differentiation between benign and malignant cases. When we tested these results in the benign prostate tissues from patients with cancer, pepsinogen C maintained the expression pattern. In terms of prostate specific membrane antigen, despite over expression in most cases (mean 12 times), 2 cases (12%) presented with under expression. Conclusions: Pepsinogen C tissue expression may constitute a powerful adjunctive method to prostate biopsy in the diagnosis of prostate cancer cases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aim: To look at the characteristics of Postgraduate Hospital Educational Environment Measure (PHEEM) using data from the UK, Brazil, Chile and the Netherlands, and to examine the reliability and characteristics of PHEEM, especially how the three PHEEM subscales fitted with factors derived statistically from the data sets. Methods: Statistical analysis of PHEEM scores from 1563 sets of data, using reliability analysis, exploratory factor analysis and correlations of factors derived with the three defined PHEEM subscales. Results: PHEEM was very reliable with an overall Cronbach`s alpha of 0.928. Three factors were derived by exploratory factor analysis. Factor One correlated most strongly with the teaching subscale (R=0.802), Factor Two correlated most strongly with the role autonomy subscale (R=0.623) and Factor Three correlated most strongly with the social support subscale (R=0.538). Conclusions: PHEEM is a multi-dimensional instrument. Overall, it is very reliable. There is a good fit of the three defined subscales, derived by qualitative methods, with the three principal factors derived from the data by exploratory factor analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Biologic valve re-replacement was examined in a series of 1343 patients who underwent aortic valve replacement at The Prince Charles Hospital, Brisbane, with a cryopreserved or 4 degrees C stored allograft valve or a xenograft valve, A parametric model approach was used to simultaneously model the competing risks of death without re-replacement and re-replacement before death, One hundred eleven patients underwent a first re-replacement for a variety of reasons (69 patients with xenograft valves, 28 patients with 4 degrees C stored allograft valves, and 14 patients with cryopreserved allograft valves), By multivariable analysis younger age at operation was associated with xenograft, 4 degrees C stored allograft, and cryopreserved allograft valve re-replacement, However, this effect was examined in the context of longer survival of younger patients, which increases their exposure to the risk of re-replacement as compared with that in older patients whose decreased survival reduced their probability of requiring valve re-replacement, In patients older than 60 years at the time of aortic valve replacement, the probability of re-replacement (for any reason) before death was similar for xenografts and cryopreserved allograft valves but higher for 4 degrees C stored valves, However, in patients younger than 60 years, the probability of re-replacement at any time during the remainder of the life of the patient was lower with the cryopreserved allograft valve compared with the xenograft valve and 4 degrees C stored allografts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mechanisms of leukocyte NADPH oxidase regulation remain actively investigated. We showed previously that vascular and macrophage oxidase complexes are regulated by the associated redox chaperone PDI. Here, we investigated the occurrence and possible underlying mechanisms of PDI-mediated regulation of neutrophil NADPH oxidase. In a semirecombinant cell-free system, PDI inhibitors scrRNase (100 mu g/mL) or bacitracin (1 mM) near totally suppressed superoxide generation. Exogenously incubated, oxidized PDI increased (by similar to 40%), whereas PDIred diminished (by similar to 60%) superoxide generation. No change occurred after incubation with PDI serine-mutated in all four redox cysteines. Moreover, a mimetic CxxC PDI inhibited superoxide production by similar to 70%. Thus, oxidized PDI supports, whereas reduced PDI down-regulates, intrinsic membrane NADPH oxidase complex activity. In whole neutrophils, immunoprecipitation and colocalization experiments demonstrated PDI association with membrane complex subunits and prominent thiol-mediated interaction with p47(phox) in the cytosol fraction. Upon PMA stimulation, PDI was mobilized from azurophilic granules to cytosol but did not further accumulate in membranes, contrarily to p47(phox). PDI-p47(phox) association in cytosol increased concomitantly to opposite redox switches of both proteins; there was marked reductive shift of cytosol PDI and maintainance of predominantly oxidized PDI in the membrane. Pulldown assays further indicated predominant association between PDIred and p47(phox) in cytosol. Incubation of purified PDI (> 80% reduced) and p47(phox) in vitro promoted their arachidonate-dependent association. Such PDI behavior is consistent with a novel cytosolic regulatory loop for oxidase complex (re) cycling. Altogether, PDI seems to exhibit a supportive effect on NADPH oxidase activity by acting as a redox-dependent enzyme complex organizer. J. Leukoc. Biol. 90: 799-810; 2011.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: The aim of this study was to evaluate the influence of estrogen deficiency on bone around osseointegrated dental implants in a rat jaw model. Materials and Methods: This study used 16 female rats that had the first molars bilaterally extracted and were allowed to heal for 30 days before implant placement. Sixty days after implant placement, the animals were randomly subjected to sham surgery or ovariectomy (OVX). The animals were euthanized 90 days after OVX. Bone-to-implant contact, bone area fraction occupancy between implant threads, mineral density, turnover markers, and cells positive for tartrate-resistant acid phosphatase were assessed for the 2 groups. Results: The results showed that OVX group presented a decrease of systemic bone density, alterations in bone turnover markers, and an increase of cells positive for tartrate-resistant acid phosphatase compared with the sham-surgery group. However, no difference relative to bone-to-implant contact and bone area fraction occupancy was observed between groups. Conclusions: The findings of this study demonstrate that estrogen deficiency may not be considered a risk factor for osseointegrated implant failure in jaw bone. (C) 2011 American Association of Oral and Maxillofacial Surgeons J Oral Maxillofac Surg 69:1911-1918, 2011

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Increased Kt concentration in seawater induces metamorphosis in the ascidian Herdmania momus. Larvae cultivated at 24 degrees C exhibit highest rates of metamorphosis when treated with 40 mM KCl-elevated seawater at 21 degrees C. At 24 degrees C, H. momus larvae develop competence to respond to KCl-seawater and initiate metamorphosis approximately 3 h after hatching. Larval trunks and tails separated from the anterior papillae region, but maintained in a common tunic at a distance of greater than 60 mu m, do not undergo metamorphosis when treated with KCl-seawater; normal muscle degradation does not occur in separated tails while ampullae develop from papillae-containing anterior fragments. Normal programmed degradation of myofibrils occurs when posterior fragments are fused to papillae-containing anterior fragments. These data indicate that H. momus settlement and metamorphosis only occurs when larvae have attained competence, and suggest that an anterior signalling centre is stimulated to release a factor that induces metamorphosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to investigate the effects of a specific cognitive race plan on 100 m sprint performance, Twelve elite sprinters (11 male and 1 female) performed 100 m time trials under normal (control) conditions and then under experimental conditions (use of race cues). In the experimental condition, participants were asked to think about specific thought content in each of three segments of the 100 m. A multiple baseline design was employed. A mean improvement of 0.26 s was found. Eleven of the 12 participants showed improvement using the specific cognitive race plan (p < .005). Participants also produced more consistent sprint performances when using the cues (p < .01). Subjective evaluations made by the participants unanimously supported the use of the race plan for optimizing sprint performance. Environmental conditions, effort, and practice effects were considered as possible influences on the results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the effect of two anti-pronation taping techniques on vertical navicular height, an indicator of foot pronation, after its application and 20 min of exercise. The taping techniques were: the low dye (LD) and low dye with the addition of calcaneal slings and reverse sixes (LDCR). A repeated measures study was used. It found that LDCR was superior to LD and control immediately after application and exercise. LD was better than control immediately after application but not after exercise. These findings provide practical directions to clinicians regularly using anti-pronation taping techniques.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.