925 resultados para Thermal neutron fluence


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents in detail a theoretical adaptive model of thermal comfort based on the “Black Box” theory, taking into account factors such as culture, climate, social, psychological and behavioural adaptations, which have an impact on the senses used to detect thermal comfort. The model is called the Adaptive Predicted Mean Vote (aPMV) model. The aPMV model explains, by applying the cybernetics concept, the phenomena that the Predicted Mean Vote (PMV) is greater than the Actual Mean Vote (AMV) in free-running buildings, which has been revealed by many researchers in field studies. An Adaptive coefficient (λ) representing the adaptive factors that affect the sense of thermal comfort has been proposed. The empirical coefficients in warm and cool conditions for the Chongqing area in China have been derived by applying the least square method to the monitored onsite environmental data and the thermal comfort survey results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The microstructure and thermal characteristics of Thai indigenous (Gallus domesticus) and broiler chicken (commercial line CP707) biceps femoris and pectoralis muscles were determined. Perimysium thicknesses were 14.2 mum for biceps femoris muscle and 7.10 mum for pectoralis muscle of indigenous chicken muscles, thicker than those of broiler muscles, which were 9.93 mum for biceps femoris muscle and 3.87 mum for pectoralis muscle (P < 0.05). Five endothermic peaks with peak transition temperatures (T-p) of 54.9, 61.7, 65.4, 70.6, and 76.1degreesC were obtained for broiler pectoralis muscle, whereas only 3 endothermic peaks (T-P of 56.6, 62.6, and 74.9degreesC were obtained for broiler biceps femoris muscle. Thai indigenous biceps femoris and pectoralis muscles had endothermic peaks with T-P ranges of 53.5 to 54.8, 60.7 to 61.9, and 75.9 to 76.9degreesC. The fiber diameters of Thai indigenous chicken muscles were greater (P < 0.05) than those of the broiler, 31.7 vs. 20.4 mum for biceps femoris muscle and 28.9 vs. 26.6 pm for pectoralis muscle, respectively. After cooking at 80degreesC for 10 min, the fiber diameter of indigenous chicken muscles significantly decreased while those of the broiler significantly increased. The mean of sarcomere lengths of the raw muscles ranged from 1.56 to 1.64 mun and decreased to 0.92 to 1.32 mum (P < 0.001) for broiler muscles and 1.22 to 1.35 mum (P < 0.001) for indigenous chicken muscles after cooking. The perimysium and endomysium of broiler muscles melted after cooking at 80degreesC, however, only slight disintegration was observed in these tissues in the indigenous chicken muscles.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A combined mathematical model for predicting heat penetration and microbial inactivation in a solid body heated by conduction was tested experimentally by inoculating agar cylinders with Salmonella typhimurium or Enterococcus faecium and heating in a water bath. Regions of growth where bacteria had survived after heating were measured by image analysis and compared with model predictions. Visualisation of the regions of growth was improved by incorporating chromogenic metabolic indicators into the agar. Preliminary tests established that the model performed satisfactorily with both test organisms and with cylinders of different diameter. The model was then used in simulation studies in which the parameters D, z, inoculum size, cylinder diameter and heating temperature were systematically varied. These simulations showed that the biological variables D, z and inoculum size had a relatively small effect on the time needed to eliminate bacteria at the cylinder axis in comparison with the physical variables heating temperature and cylinder diameter, which had a much greater relative effect. (c) 2005 Elsevier B.V All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lipid oxidation was studied in beef and chicken muscle after high pressure treatment (0.1-800 MPa) at different temperatures (20-70 degrees C for 20 min, prior to storage at 4 degrees C for 7 days. Pressure treatment of beef samples at room temperature led to increases in TBARS values after 7 days storage at 4 degrees C; however, the increases were more marked after treatment at pressures >= 400 MPa (at least fivefold) than after treatment at lower pressures (less than threefold). Similar results were found in those samples treated at 40 degrees C, but at 60 degrees C and 70 degrees C pressure had little additional effect on the oxidative stability of the muscle. Pressure treatments of 600 MPa and 800 MPa, at all temperatures. induced increased rates of lipid oxidation in chicken muscle, but, in general, chicken muscle was more stable than beef to pressure. and the catalytic effect of pressure was still seen at the higher temperatures of 50 degrees C, 60 degrees C and 70 degrees C. The addition of 1%, Na(2)EDTA decreased TBARS values of the beef muscle during storage and inhibited the increased rates of lipid oxidation induced by pressure. The inhibition by vitamin E (0.05% w/w) and BHT (0.02% w/w), either alone or in combination, were less marked than seen with Na(2)EDTA, suggesting that transition metal ions released from insoluble complexes are of major importance in catalysing lipid oxidation in pressure-treated muscle foods. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effects of high pressure (to 800 MPa) applied at different temperatures (20-70 degreesC) for 20 min on beef post-rigor longissimus dorsi texture were studied. Texture profile analysis showed that when heated at ambient pressure there was the expected increase in hardness with increasing temperature and when pressure was applied at room temperature there was again the expected increase in hardness with increasing pressure. Similar results to those found at ambient temperature were found when pressure was applied at 40 degreesC. However, at higher temperatures, 60 and 70 degreesC it was found that pressures of 200 MPa caused large and significant decreases in hardness. The results found for hardness were mirrored by those for gumminess and chewiness. To further understand the changes in texture observed, intact beef longissimus dorsi samples and extracted myofibrils were both subjected to differential scanning calorimetry after being subjected to the same pressure/temperature regimes. As expected collagen was reasonably inert to pressure and only at temperatures of 60-70 degreesC was it denatured/unfolded. However, myosin was relatively easily unfolded by both pressure and temperature and when pressure denatured a new and modified structure was formed of low thermal stability. Although this new structure had low thermal stability at ambient pressure it still formed in both the meat and myofibrils when pressure was applied at 60 degreesC. It seems unlikely that structurally induced changes can be a major cause of the significant loss of hardness observed when beef is treated at high temperature (60-70 degreesC) and 200 MPa and it is suggested that accelerated proteolysis under these conditions is the major cause. (C) 2004 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The flavor characteristics of pennywort juices with added sugar treated by ultra-high pressure, pasteurization, and sterilization were investigated using solid phase microextraction combined with gas chromatography-mass spectrometry. It was found that sesquiterpene hydrocarbons comprised the major class of volatile components present and the juices had a characteristic aroma due to the presence of volatiles including beta-caryophyllene and humulene and alpha-copaene. In comparison with heated juices, HPP-treated samples could retain more volatile compounds such as linalool and geraniol similar to those present in fresh juice, whereas some volatiles such as alpha-terpinene and ketone class were apparently formed by thermal treatment. All processing operations produced juice that was not significantly different in the concentration of total volatiles. Practical Application: Pennywort juice is considered a nutraceutical drink for health benefits. Therefore, to preserve all aroma and active components in this juice, a nonthermal process such as ultra-high pressure should be a more appropriate technique for retention of its nutritive values than pasteurization and sterilization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Modal filtering is based on the capability of single-mode waveguides to transmit only one complex amplitude function to eliminate virtually any perturbation of the interfering wavefronts, thus making very high rejection ratios possible in a nulling interferometer. In the present paper we focus on the progress of Integrated Optics in the thermal infrared [6-20 mu m] range, one of the two candidate technologies for the fabrication of Modal Filters, together with fiber optics. In conclusion of the European Space Agency's (ESA) "Integrated Optics for Darwin" activity, etched layers of clialcogenide material deposited on chalcogenide glass substrates was selected among four candidates as the technology with the best potential to simultaneously meet the filtering efficiency, absolute and spectral transmission, and beam coupling requirements. ESA's new "Integrated Optics" activity started at mid-2007 with the purpose of improving the technology until compliant prototypes can be manufactured and validated, expectedly by the end of 2009. The present paper aims at introducing the project and the components requirements and functions. The selected materials and preliminary designs, as well as the experimental validation logic and test benches are presented. More details are provided on the progress of the main technology: vacuum deposition in the co-evaporation mode and subsequent etching of chalcogenide layers. In addition., preliminary investigations of an alternative technology based on burying a chalcogenide optical fiber core into a chalcogenide substrate are presented. Specific developments of anti-reflective solutions designed for the mitigation of Fresnel losses at the input and output surface of the components are also introduced.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We discuss a novel approach to the development of an ultrasonic optical force-feedback measurement microphone suitable for observing biophotonic related photoacoustic and photothermal phenomena at high modulation frequencies and spatial resolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The thermal decomposition of the complex K-4[Ni(NO2)6]center dot H2O has been investigated over the temperature range 25-600 degrees C by a combination of infrared spectroscopy, powder X-ray diffraction, FAB-mass spectrometry and elemental analysis. The first stage of reaction is loss of water and isomerisation of one of the coordinated nitro groups to form the complex K-4 [Ni(NO2)(4) (ONO)]center dot NO2. At temperatures around 200 degrees C the remaining nitro groups within the complex isomerise to the chelating nitrite form and this process acts as a precursor to the loss of NO2 gas at temperatures above 270 degrees C. The product, which is stable up to 600 degrees C, is the complex K-4[Ni(ONO)(4)]center dot NO2, where the nickel atom is formally in the +1 oxidation state. (c) 2005 Elsevier B.V. All rights reserved.