Método dinâmico aplicado para antenas cilíndricas

Nowadays there has been a major breakthrough in the aerospace area, with regard to rocket launches to research, experiments, telemetry system, remote sensing, radar system (tracking and monitoring), satellite communications system and insertion of satellites in orbit. This work aims at the application of a circular cylindrical microstrip antenna, ring type, and other cylindrical rectangular in structure of a rocket or missile to obtain telemetry data, operating in the range of 2 to 4 GHz, in S-band. Throughout this was developed just the theoretical analysis of the Transverse transmission line method which is a method of rigorous analysis in spectral domain, for use in rockets and missiles. This analyzes the spread in the direction "`1;" , transverse to dielectric interfaces "z" and "φ", for cylindrical coordinates, thus taking the general equations of electromagnetic fields in function of e [1]. It is worth mentioning that in order to obtain results, simulations and analysis of the structure under study was used HFSS program (High Frequency Structural Simulator) that uses the finite element method. With the theory developed computational resources were used to obtain the numerical calculations, using Fortran Power Station, Scilab and Wolfram Mathematica ®. The prototype was built using, as a substrate, the ULTRALAM ® 3850, of Rogers Corporation, and an aluminum plate as a cylindrical structure used to support. The agreement between the measured and simulated results validate the established processes. Conclusions and suggestions are presented for continuing this work

Avaliação da estrutura de tecidos técnicos como elemento reforçante em compósitos poliméricos sistema poliéster isoftálico

Materials known as technical textiles can be defined as structures designed and developed to meet specific functional requirements of various industry sectors, which is the case in automotive and aerospace industries, and other specific applications. Therefore, the purpose of this work presents the development and manufacture of polymer composite with isophthalic polyester resin. The reinforcement of the composite structure is a technical textile fabric made from high performance fibers, aramid (Kevlar 49) and glass fiber E. The fabrics are manufactured by the same method, with the aim of improving the tensile strength of the resulting polymer composite material. The fabrics, we developed some low grammage technical textile structures in laboratory scale and differentiated-composition type aramid (100%), hybrid 1 aramid fiber / glass (65/35%) and hybrid 2 aramid fiber / glass (85/15% ) for use as a reinforcing element in composite materials with unsaturated isophthalic polyester matrix. The polymer composites produced were tested in uniaxial tensile fracture surface and it´s evaluated by SEM. The purpose of this work characterize the performance of polymer composites prepared, identifying changes and based on resistance to strain corresponding to the mechanical behavior. The objectives are to verify the capability of using this reinforcement structure, along with the use of high performance fibers and resin in terms of workability and mechanical strength; verify the adherence of the fiber to the matrix and the fracture surface by electron microscopy scanning and determination of tensile strength by tensile test. The results indicate that, in a comparative study to the response of uniaxial tensile test for tensile strength of the composites and the efficiency of the low percentage of reinforcement element, being a technical textile fabric structure that features characteristic of lightness and low weight added in polymer composites

Melhoramento genético da mamona visando incremento de flores femininas

O objetivo deste trabalho foi testar métodos de seleção visando ao aumento de flores femininas na população FCA-UNESP-PB de mamona (Ricinus communis L.). A seleção foi realizada no município de Botucatu (SP), na safrinha de 2007. Por meio de seleção massal, foram selecionadas plantas com racemo primário estritamente feminino. Destas plantas, as que tinham reversão sexual foram autofecundadas. As avaliações foram realizadas na safrinha de 2008 em Botucatu e São Manuel (SP), onde foram comparados os tratamentos: método de seleção massal; método de seleção massal com autofecundação e testemunha (racemos de plantas colhidos ao acaso, sem seleção). Foram avaliados: porcentagem de flores femininas do racemo primário (%), produtividade de grãos (kg ha-1) e teor de óleo das sementes (%). O delineamento experimental utilizado foi o de blocos casualizados com 30 repetições. Os dados foram submetidos à análise de variância individual para cada local e conjuntamente para os dois locais, pelo teste F a 1% de probabilidade. Mediante os resultados conclui- se que o método de seleção massal com autofecundação foi aquele que proporcionou maiores valores de porcentagem de flores femininas no racemo primário, com ganho fenotípico realizado de 18% em Botucatu e 29% em São Manuel (SP). Por meio dos métodos de seleção, notou-se comportamento diferencial em relação aos locais para a característica produtividade de grãos, e o método seleção massal com autofecundação proporcionou a menor produtividade. No teor de óleo não houve diferenças significativas entre os métodos e os locais avaliados.

Net melon resistance to Didymella bryoniae according to grafting and potassium levels

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Aplicação de microemulsões na solubilização de frações pesadas de petróleo

This work presents studies related to the use of microemulsions in the solubilization of heavy crude oil fractions responsible by the formation of deposits. The first stage of the work was addressed to the construction of phases diagrams, with the intention of determining the area within which the microemulsion is formed. The following systems were studied: UNITOL L 90 n-Butanol - Water - Kerosene (system 1); UNITOL L 90 - n-Butanol - Water - Xylene (system 2); UNITOL L 90 n-Butanol - Water - Kerosene/Xylene 10% (system 3); UNITOL L 90 - Sec-Butanol - Water - Xylene (system 4). In parallel experiments of physical adsorption were carried out by the static method, with the intention of simulating natural conditions of reservoirs. Crude oil of the Fazenda Belém field (Rio Grande do Norte), was used as solute, xylene as solvent and the Assu sandstone (Rio Grande do Norte, Brazil) and Botucatu sandstone (Paraná, Brazil) as rock reservoirs. The curves of adsorption presented the S format type, in agreement with the classification proposed by Giles, Smith and Huitson (1974). The solubilization process was accomplished in the batch method, by varying the time of agitation, the microemulsions and the solid/solution ratio. The experiments showed that the microemulsions presented high efficiency in the solubilization of the crude oil adsorbed on the sandstones. System 2 presented an efficiency of 99% for the Assu sandstone and 97% for the Botucatu sandstone

Sensor array made with nanostructured films to detect a phenothiazine compound

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Antibody-targeted horseradish peroxidase associated with indole-3-acetic acid induces apoptosis in vitro in hematological malignancies

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

LC Evaluation of Intestinal Transport of Praziquantel

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Evaluation of Preservative Effectiveness of Liquid Crystalline Systems with Retynil Palmitate by the Challenge Test and D-value

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

On the Generalized Mittag-Leffler Function and its Application in a Fractional Telegraph Equation

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Loss minimization by the predictor-corrector modified barrier approach

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Modelos de sobrevivência com fração de cura e omissão nas covariáveis

In this work we study the survival cure rate model proposed by Yakovlev (1993) that are considered in a competing risk setting. Covariates are introduced for modeling the cure rate and we allow some covariates to have missing values. We consider only the cases by which the missing covariates are categorical and implement the EM algorithm via the method of weights for maximum likelihood estimation. We present a Monte Carlo simulation experiment to compare the properties of the estimators based on this method with those estimators under the complete case scenario. We also evaluate, in this experiment, the impact in the parameter estimates when we increase the proportion of immune and censored individuals among the not immune one. We demonstrate the proposed methodology with a real data set involving the time until the graduation for the undergraduate course of Statistics of the Universidade Federal do Rio Grande do Norte

Synthesis and characterization of Fe(III)-doped ceramic membranes of titanium dioxide and its application in photoelectrocatalysis of a textile dye

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

2D evaluation of crack openings using smeared and embedded crack models

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)