916 resultados para Regulatory Sequences, Nucleic Acid


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Rv3291c gene from Mycobacterium tuberculosis codes for a transcriptional regulator belonging to the (leucine responsive regulatory protein/regulator of asparigine synthase C gene product) Lrp/AsnC-family. We have identified a novel effectorbinding site from crystal structures of the apo protein, complexes with a variety of amino acid effectors, X-ray based ligand screening and qualitative fluorescence spectroscopy experiments. The new effector site is in addition to the structural characterization of another distinct site in the protein conserved in the related AsnC-family of regulators. The structures reveal that the ligandbinding loops of two crystallographically ndependent subunits adopt different conformations to generate two distinct effector-binding sites. A change in the conformation of the binding site loop 100–106 in the B subunit is apparently necessary for octameric association and also allows the loop to interact with a bound ligand in the newly identified effector-binding site. There are four sites of each kind in the octamer and the protein preferentially binds to aromatic amino acids. While amino acids like Phe, Tyr and Trp exhibit binding to only one site, His exhibits binding to both sites. Binding of Phe is accompanied by a conformational change of 3.7A ° in the 75–83 loop, which is advantageously positioned to control formation of higher oligomers. Taken together, the present studies suggest an elegant control mechanism for global transcription regulation involving binding of ligands to the two sites, individually or collectively.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Biomedical researchers and clinicians working with molecular technologies in routine clinical practice often need to review the available literature to gather information regarding specific sequences of nucleic acids. This includes, for instance, finding articles related to a concrete DNA sequence, or identifying empirically-validated primer/probe sequences to evaluate the presence of different micro-organisms. Unfortunately, these hard and time-consuming tasks often need to be manually performed by researchers themselves since no publicly available biomedical literature search engine, e.g. PubMed, PubMed Central (PMC), etc., provides the required search functionalities. In this article, we describe PubDNA Finder, a web service that enables users to perform advanced searches on PubMed Central-indexed full text articles with sequences of nucleic acids

Relevância:

40.00% 40.00%

Publicador:

Resumo:

MLN64 is a protein that is highly expressed in certain breast carcinomas. The C terminus of MLN64 shares significant homology with the steroidogenic acute regulatory protein (StAR), which plays a key role in steroid hormone biosynthesis by enhancing the intramitochondrial translocation of cholesterol to the cholesterol side-chain cleavage enzyme. We tested the ability of MLN64 to stimulate steroidogenesis by using COS-1 cells cotransfected with plasmids expressing the human cholesterol side-chain cleavage enzyme system and wild-type and mutant MLN64 proteins. Wild-type MLN64 increased pregnenolone secretion in this system 2-fold. The steroidogenic activity of MLN64 was found to reside in the C terminus of the protein, because constructs from which the C-terminal StAR homology domain was deleted had no steroidogenic activity. In contrast, removal of N-terminal sequences increased MLN64’s steroidogenesis-enhancing activity. MLN64 mRNA was found in many human tissues, including the placenta and brain, which synthesize steroid hormones but do not express StAR. Western blot analysis revealed the presence of lower molecular weight immunoreactive MLN64 species that contain the C-terminal sequences in human tissues. Homologs of both MLN64 and StAR were identified in Caenorhabditis elegans, indicating that the two proteins are ancient. Mutations that inactivate StAR were correlated with amino acid residues that are identical or similar among StAR and MLN64, indicating that conserved motifs are important for steroidogenic activity. We conclude that MLN64 stimulates steroidogenesis by virtue of its homology to StAR.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5′ flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at −646 and −395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at −395 bp. There was no reaction at −395 bp with anti-Sp1 antibody nor with either antibody at −646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Abscisic acid (ABA), a cleavage product of carotenoids, is involved in stress responses in plants. A well known response of plants to water stress is accumulation of ABA, which is caused by de novo synthesis. The limiting step of ABA biosynthesis in plants is presumably the cleavage of 9-cis-epoxycarotenoids, the first committed step of ABA biosynthesis. This step generates the C15 intermediate xanthoxin and C25-apocarotenoids. A cDNA, PvNCED1, was cloned from wilted bean (Phaseolus vulgaris L.) leaves. The 2,398-bp full-length PvNCED1 has an ORF of 615 aa and encodes a 68-kDa protein. The PvNCED1 protein is imported into chloroplasts, where it is associated with the thylakoids. The recombinant protein PvNCED1 catalyzes the cleavage of 9-cis-violaxanthin and 9′-cis-neoxanthin, so that the enzyme is referred to as 9-cis-epoxycarotenoid dioxygenase. When detached bean leaves were water stressed, ABA accumulation was preceded by large increases in PvNCED1 mRNA and protein levels. Conversely, rehydration of stressed leaves caused a rapid decrease in PvNCED1 mRNA, protein, and ABA levels. In bean roots, a similar correlation among PvNCED1 mRNA, protein, and ABA levels was observed. However, the ABA content was much less than in leaves, presumably because of the much smaller carotenoid precursor pool in roots than in leaves. At 7°C, PvNCED1 mRNA and ABA were slowly induced by water stress, but, at 2°C, neither accumulated. The results provide evidence that drought-induced ABA biosynthesis is regulated by the 9-cis-epoxycarotenoid cleavage reaction and that this reaction takes place in the thylakoids, where the carotenoid substrate is located.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The efficient expression of therapeutic genes in target cells or tissues is an important component of efficient and safe gene therapy. Utilizing regulatory elements from the human cytokeratin 18 (K18) gene, including 5′ genomic sequences and one of its introns, we have developed a novel expression cassette that can efficiently express reporter genes, as well as the human cystic fibrosis transmembrane conductance regulator (CFTR) gene, in cultured lung epithelial cells. CFTR transcripts expressed from the native K18 enhancer/promoter include two alternative splicing products, due to the activation of two cryptic splice sites in the CFTR coding region. Modification of the K18 intron and CFTR cDNA sequences eliminated the cryptic splice sites without changing the CFTR amino acid sequence, and led to enhanced CFTR mRNA and protein expression as well as biological function. Transgenic expression analysis in mice showed that the modified expression cassette can direct efficient and epithelium-specific expression of the Escherichia coli LacZ gene in the airways of fetal lungs, with no detectable expression in lung fibroblasts or endothelial cells. This is the first expression cassette which selectively directs lung transgene expression for CFTR gene therapy to airway epithelia.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The Arabidopsis thaliana NPR1 has been shown to be a key regulator of gene expression during the onset of a plant disease-resistance response known as systemic acquired resistance. The npr1 mutant plants fail to respond to systemic acquired resistance-inducing signals such as salicylic acid (SA), or express SA-induced pathogenesis-related (PR) genes. Using NPR1 as bait in a yeast two-hybrid screen, we identified a subclass of transcription factors in the basic leucine zipper protein family (AHBP-1b and TGA6) and showed that they interact specifically in yeast and in vitro with NPR1. Point mutations that abolish the NPR1 function in A. thaliana also impair the interactions between NPR1 and the transcription factors in the yeast two-hybrid assay. Furthermore, a gel mobility shift assay showed that the purified transcription factor protein, AHBP-1b, binds specifically to an SA-responsive promoter element of the A. thaliana PR-1 gene. These data suggest that NPR1 may regulate PR-1 gene expression by interacting with a subclass of basic leucine zipper protein transcription factors.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The transcription of fatty acid synthase (FAS), a central enzyme in de novo lipogenesis, is dramatically induced by fasting/refeeding and insulin. We reported that upstream stimulatory factor binding to the −65 E-box is required for induction of the FAS transcription by insulin in 3T3-L1 adipocytes. On the other hand, we recently found that two upstream 5′ regions are required for induction in vivo by fasting/refeeding and insulin; one at −278 to −131 albeit at a low level, and the other at −444 to −278 with an E-box at −332 where upstream stimulatory factor functions for maximal induction. Here, we generated double transgenic mice carrying the chloramphenicol acetyltransferase reporter driven by the various 5′ deletions of the FAS promoter region and a truncated active form of the sterol regulatory element (SRE) binding protein (SREBP)-1a. We found that SREBP participates in the nutritional regulation of the FAS promoter and that the region between −278 and −131 bp is required for SREBP function. We demonstrate that SREBP binds the −150 canonical SRE present between −278 and −131, and SREBP can function through the −150 SRE in cultured cells. These in vivo and in vitro results indicate that SREBP is involved in the nutritional induction of the FAS promoter via the −278/−131 region and that the −150 SRE is the target sequence.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We have previously shown that Y box-binding protein-1 (YB-1) binds preferentially to cisplatin-modified Y box sequences. Based on structural and biochemical data, we predicted that this protein binds single-stranded nucleic acids. In the present study we confirmed the prediction and also discovered some unexpected functional features of YB-1. We found that the cold shock domain of the protein is necessary but not sufficient for double-stranded DNA binding while the C-tail domain interacts with both single-stranded DNA and RNA independently of the cold shock domain. In an in vitro translation system the C-tail domain of the protein inhibited translation but the cold shock domain did not. Both in vitro pull-down and in vivo co-immunoprecipitation assays revealed that YB-1 can form a homodimer. Deletion analysis mapped the C-tail domain of the protein as the region of homodimerization. We also characterized an intrinsic 3′→5′ DNA exonuclease activity of the protein. The region between residues 51 and 205 of its 324-amino acid extent is required for full exonuclease activity. Our findings suggest that YB-1 functions in regulating DNA/RNA transactions and that these actions involve different domains.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Evolutionary selection of sequences is studied with a knowledge-based Hamiltonian to find the design principle for folding to a model protein structure. With sequences selected by naive energy minimization, the model structure tends to be unstable and the folding ability is low. Sequences with high folding ability have only the low-lying energy minimum but also an energy landscape which is similar to that found for the native sequence over a wide region of the conformation space. Though there is a large fluctuation in foldable sequences, the hydrophobicity pattern and the glycine locations are preserved among them. Implications of the design principle for the molecular mechanism of folding are discussed.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Recombinant antibodies capable of sequence-specific interactions with nucleic acids represent a class of DNA- and RNA-binding proteins with potential for broad application in basic research and medicine. We describe the rational design of a DNA-binding antibody, Fab-Ebox, by replacing a variable segment of the immunoglobulin heavy chain with a 17-amino acid domain derived from TFEB, a class B basic helix-loop-helix protein. DNA-binding activity was studied by electrophoretic mobility-shift assays in which Fab-Ebox was shown to form a specific complex with DNA containing the TFEB recognition motif (CACGTG). Similarities were found in the abilities of TFEB and Fab-Ebox to discriminate between oligodeoxyribonucleotides containing altered recognition sequences. Comparable interference of binding by methylation of cytosine residues indicated that Fab-Ebox and TFEB both contact DNA through interactions along the major groove of double-stranded DNA. The results of this study indicate that DNA-binding antibodies of high specificity can be developed by using the modular nature of both immunoglobulins and transcription factors.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

1976 ed. issued under title: Variable regions of immunoglobulin chains.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A single-tube RT-PCR technique generated a 387 bp or 300 bp cDNA amplicon covering the F-0 cleavage site or the carboxyl (C)-terminus of the HN gene, respectively, of Newcastle disease virus (NDV) strain 1-2. Sequence analysis was used to deduce the amino acid sequences of the cleavage site of F protein and the C-terminus of HN protein, which were then compared with sequences for other NDV strains. The cleavage site of NDV strain 1-2 had a sequence Motif of (112)RKQGRLIG(119), consistent with an avirulent phenotype. Nucleotide sequencing and deduction of amino acids at the C-terminus of HN revealed that strain 1-2 had a 7-amino-acid extension (VEILKDGVREARSSR). This differs from the virulent viruses that caused outbreaks of Newcastle disease in Australia in the 1930s and 1990s, which have HN extensions of 0 and 9 amino acids, respectively. Amino acid sequence analyses of the F and HN genes of strain 1-2 confirmed its avirulent nature and its Australian origin.