884 resultados para Multi-objective function


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective The aim of this study was to study the effects of Tribulus terrestris on sexual function in menopausal women. Methods This was a prospective, randomized, double-blind, placebo-controlled clinical trial that included 60 postmenopausal women with sexual dysfunction. The women were divided into two groups, placebo group and Tribulus group, and evaluated by using the Sexual Quotient-female version (SQ-F) and Female Intervention Efficacy Index (FIEI) questionnaires. Results There was no significant difference between the groups in age, age at menopause, civil status, race, and religion. In the evaluation with the SQ-F questionnaire, there were significant differences between the placebo (7.6±3.2) and Tribulus (10.2±3.2) groups in the domains of desire and sexual interest (p d" 0.001), foreplay (3.3±1.5 versus 4.2±1.0) (p d" 0.01), arousal and harmonious interaction with the partner (5.7±2.1 versus 7.2±2.6) (p d" 0.01), and comfort in sexual intercourse (6.5±2.4 versus 8.0±1.9) (p d" 0.01). There was no significant difference between the placebo and Tribulus groups in the domains of orgasm and sexual satisfaction (p = 0.28). In the FIEI questionnaire, there was a significant improvement (p < 0.001) in the domains of vaginal lubrication during coitus and/or foreplay (20 versus 83.3%), sensation in the genitalia during sexual intercourse or other stimuli (16.7 versus 76.7%), sensation in the genital region (20 versus 70%), sexual intercourse and/or other sexual stimulations (13.3 versus 43.3%), and the ability to reach orgasm (20% versus 73.3%). There was no significant difference in adverse effects between the two groups. Conclusions After 90 days of treatment, at the doses used, we found Tribulus terrestris to be effective in treating sexual problems among menopausal women.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this thesis was to examine the potential of multi-axis solutions in packaging machines produced in Europe. The definition of a multi-axis solution in this study is a construction that uses a common DC bus power supply for different amplifiers running the axes and the intelligence is centralized into one unit. The cost structure of a packaging machine was gained from an automation research, which divided the machines according to automation categories. The automation categories were then further divided into different sub-components by evaluating the ratio of multi-axis solutions compared to other automation components in packaging machines. A global motion control study was used for further information. With the help of the ratio, an estimation of the potential of multi-axis solutions in each country and packaging machine sector was completed. In addition to the research, a specific questionnaire was sent to five companies to gain information about the present situation and possible trends in packaging machinery. The greatest potential markets are in Germany and Italy, which are also the largest producers of packaging machinery in Europe. The greatest growth in the next few years will be seen in Turkey where the annual growth rate equals the general machinery production rate in Asia. The greatest market potential of the Nordic countries is found in Sweden in 35th position on the list. According to the interviews, motion control products in packaging machines will retain their current power levels, as well as the number of axes in the future. Integrated machine safety features together with a universal programming language are the desired attributes of the future. Unlike generally in industry, the energy saving objectives are and will remain insignificant in the packaging industry.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

More than ever, education organisations are experiencing the need to develop new services and processes to satisfy expanding and changing customer needs and to adapt to the environmental changes and continually tightening economic situation. Innovation has been found in many studies to have a crucial role in the success of an organisation, both in the private and public sectors, in formal education and in manufacturing and services alike. However, studies concerning innovation in non-formal adult education organisations, such as adult education centres (AECs) in Finland, are still lacking. This study investigates innovation in the non-formal adult education organisation context from the perspective of organisational culture types and social networks. The objective is to determine the significant characteristics of an innovative non-formal adult education organisation. The analysis is based on data from interviews with the principals and fulltime staff of four case AECs. Before the case study, a pre-study phase is accomplished in order to obtain a preliminary understanding of innovation at AECs. The research found strong support for the need of innovation in AECs. Innovation is basically needed to accomplish the AEC system’s primary mission mentioned in the ACT on Liberal Adult Education. In addition, innovation is regarded vital to institutes and may prevent their decline. It helps the institutes to be more attractive, to enter new market, to increase customer satisfaction and to be on the cutting edge. Innovation is also seen as a solution to the shortage of resources. Innovative AECs search actively for additional resources for development work through project funding and subsidies, cooperation networks and creating a conversational and joyful atmosphere in the institute. The findings also suggest that the culture type that supports innovation at AECs is multidimensional, with an emphasis on the clan and adhocratic culture types and such values as: dynamism, future orientation, acquiring new resources, mistake tolerance, openness, flexibility, customer orientation, a risk-taking attitude, and community spirit. Active and creative internal and external cooperation also promote innovation at AECs. This study also suggests that the behaviour of a principal is crucial. The way he or she shows appreciation the staff, encouragement and support to the staff and his or her approachability and concrete participation in innovation activities have a strong effect on innovation attitudes and activities in AECs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this work was to evaluate the characteristics related to the photosynthetic ability of hybrid and inbred rice varieties, as a way to assess which of the two presented higher potential to stand out under conditions of competition. The trial was set in a greenhouse in completely randomized block design and 2 x 6 factorial scheme with four replications. Factor A consisted of rice varieties (hybrid or inbred) and factor B by competition levels. Treatments consisted in maintaining one plant of either BRS Pelota (inbred) or Inov (hybrid) variety at the center of the plot, under competition with 0, 1, 2, 3, 4 or 5 plants of the variety BRS Pelota at the periphery of the experimental unit, according to the treatment. Fifty days after emergence (DAE), sub-stomatal CO2 concentration (Ci - mmol mol-1), photosynthetic rate (A - mmol m-2 s-1) and CO2 consumed (DC - mmol mol-1) were quantified, as well as shoot dry mass(SDM).Hybrid plants present higher photosynthesis capacity than inbred plants, when competing with up to 3 times its own density. When under the same competitive intensity, hybrid plants surpass the inbred. However, it should be emphasized that, when in farm condition, the lower competitive capacity with weeds often attributed to the hybrid varieties, probably is due to their lower planting density, but if weed competition is kept at low levels, hybrid rice plants may perform in the same way or usually better than inbred plants.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Although echocardiography has been used in rats, few studies have determined its efficacy for estimating myocardial infarct size. Our objective was to estimate the myocardial infarct size, and to evaluate anatomic and functional variables of the left ventricle. Myocardial infarction was produced in 43 female Wistar rats by ligature of the left coronary artery. Echocardiography was performed 5 weeks later to measure left ventricular diameter and transverse area (mean of 3 transverse planes), infarct size (percentage of the arc with infarct on 3 transverse planes), systolic function by the change in fractional area, and diastolic function by mitral inflow parameters. The histologic measurement of myocardial infarction size was similar to the echocardiographic method. Myocardial infarct size ranged from 4.8 to 66.6% when determined by histology and from 5 to 69.8% when determined by echocardiography, with good correlation (r = 0.88; P < 0.05; Pearson correlation coefficient). Left ventricular diameter and mean diastolic transverse area correlated with myocardial infarct size by histology (r = 0.57 and r = 0.78; P < 0.0005). The fractional area change ranged from 28.5 ± 5.6 (large-size myocardial infarction) to 53.1 ± 1.5% (control) and correlated with myocardial infarct size by echocardiography (r = -0.87; P < 0.00001) and histology (r = -0.78; P < 00001). The E/A wave ratio of mitral inflow velocity for animals with large-size myocardial infarction (5.6 ± 2.7) was significantly higher than for all others (control: 1.9 ± 0.1; small-size myocardial infarction: 1.9 ± 0.4; moderate-size myocardial infarction: 2.8 ± 2.3). There was good agreement between echocardiographic and histologic estimates of myocardial infarct size in rats.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The role of airway inflammation in ventilated preterm newborns and the risk factors associated with the development of chronic lung disease are not well understood. Our objective was to analyze the association of the airway inflammatory response in ventilated preterm infants by serial measurements of TNF-a and IL-10 in tracheobronchial lavage (TBL) with perinatal factors and lung function measured early in life. A series of TBL samples were collected from ventilated preterm infants (less than 32 weeks of gestational age) and concentrations of TNF-a and IL-10 were measured by ELISA. Pulmonary function tests were performed after discharge by the raised volume rapid compression technique. Twenty-five subjects were recruited and 70 TBL samples were obtained. There was a significant positive association between TNF-a and IL-10 levels and length of time between the rupture of the amniotic membranes and delivery (r = 0.65, P = 0.002, and r = 0.57, P < 0.001, respectively). Lung function was measured between 1 and 22 weeks of corrected age in 10 patients. Multivariable analysis with adjustment for differences in lung volume showed a significant negative association between TNF-a levels and forced expiratory flow (FEF50; r = -0.6; P = 0.04), FEF75 (r = -0.76; P = 0.02), FEF85 (r = -0.75; P = 0.03), FEF25-75 (-0.71; P = 0.02), and FEV0.5 (r = -0.39; P = 0.03). These data suggest that TNF-a levels in the airways during the first days of life were associated with subsequent lung function abnormalities measured weeks or months later.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to determine the acute effect of hemodialysis on endothelial venous function and oxidative stress. We studied 9 patients with end-stage renal disease (ESRD), 36.8 ± 3.0 years old, arterial pressure 133.8 ± 6.8/80.0 ± 5.0 mmHg, time on dialysis 55.0 ± 16.6 months, immediately before and after a hemodialysis session, and 10 healthy controls matched for age and gender. Endothelial function was assessed by the dorsal hand vein technique using graded local infusion of acetylcholine (endothelium-dependent venodilation, EDV) and sodium nitroprusside (endothelium-independent venodilation). Oxidative stress was evaluated by measuring protein oxidative damage (carbonyls) and antioxidant defense (total radical trapping antioxidant potential - TRAP) in blood samples. All patients were receiving recombinant human erythropoietin for at least 3 months and were not taking nitrates or a-receptor antagonists. EDV was significantly lower in ESRD patients before hemodialysis (65.6 ± 10.5) vs controls (109.6 ± 10.8; P = 0.010) and after hemodialysis (106.6 ± 15.7; P = 0.045). Endothelium-independent venodilation was similar in all comparisons performed. The hemodialysis session significantly decreased TRAP (402.0 ± 53.5 vs 157.1 ± 28.3 U Trolox/µL plasma; P = 0.001). There was no difference in protein damage comparing ESRD patients before and after hemodialysis. The magnitude of change in the EDV was correlated negatively with the magnitude of change in TRAP (r = -0.70; P = 0.037). These results suggest that a hemodialysis session improves endothelial venous function, in association with an antioxidant effect.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to determine the prevalence of electrolyte disturbances in AIDS patients developing acute kidney injury in the hospital setting, as well as to determine whether such disturbances constitute a risk factor for nephrotoxic and ischemic injury. A prospective, observational cohort study was carried out. Hospitalized AIDS patients were evaluated for age; gender; coinfection with hepatitis; diabetes mellitus; hypertension; time since HIV seroconversion; CD4 count; HIV viral load; proteinuria; serum levels of creatinine, urea, sodium, potassium and magnesium; antiretroviral use; nephrotoxic drug use; sepsis; intensive care unit (ICU) admission, and the need for dialysis. Each of these characteristics was correlated with the development of acute kidney injury, with recovery of renal function and with survival. Fifty-four patients developed acute kidney injury: 72% were males, 59% had been HIV-infected for >5 years, 72% had CD4 counts <200 cells/mm³, 87% developed electrolyte disturbances, 33% recovered renal function, and 56% survived. ICU admission, dialysis, sepsis and hypomagnesemia were all significantly associated with nonrecovery of renal function and with mortality. Nonrecovery of renal function was significantly associated with hypomagnesemia, as was mortality in the multivariate analysis. The risks for nonrecovery of renal function and for death were 6.94 and 6.92 times greater, respectively, for patients with hypomagnesemia. In hospitalized AIDS patients, hypomagnesemia is a risk factor for nonrecovery of renal function and for in-hospital mortality. To determine whether hypomagnesemia is a determinant or simply a marker of critical illness, further studies involving magnesium supplementation in AIDS patients are warranted.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate renal function in a cohort of 98 patients with sickle cell disease (SCD) followed up at a tertiary hospital in Brazil. Clinical and laboratory characteristics at the time of the most recent medical examination were analyzed. Renal function was evaluated by the estimation of glomerular filtration rate (GFR) by the criteria of the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI). We compared patients with normal GFR to patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) and hyperfiltration (>120 mL·min-1·(1.73 m²)-1). Comparison between patients according to the use of hydroxyurea and comparison of clinical and laboratory parameters according to GFR were also carried out. Average patient age was 33.8 ± 13.3 years (range 19-67 years), and 57 (58.1%) patients were females. The comparison of patients according to GFR showed that patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) were older, had lower levels of hematocrit, hemoglobin and platelets and higher levels of urea and creatinine. Independent risk factors for decreased GFR were advanced age (OR = 21.6, P < 0.0001) and anemia (OR = 39.6, P < 0.0001). Patients with glomerular hyperfiltration tended to be younger, had higher levels of hematocrit, hemoglobin and platelets and lower levels of urea and creatinine, with less frequent urinary abnormalities. Hydroxyurea, at the dosage of 500-1000 mg/day, was being administered to 28.5% of the patients, and there was no significant difference regarding renal function between the two groups. Further studies are required to establish the best therapeutic approach to renal abnormalities in SCD.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of eccentric training on the activity of mitochondrial respiratory chain enzymes, oxidative stress, muscle damage, and inflammation of skeletal muscle. Eighteen male mice (CF1) weighing 30-35 g were randomly divided into 3 groups (N = 6): untrained, trained eccentric running (16°; TER), and trained running (0°) (TR), and were submitted to an 8-week training program. TER increased muscle oxidative capacity (succinate dehydrogenase and complexes I and II) in a manner similar to TR, and TER did not decrease oxidative damage (xylenol and creatine phosphate) but increased antioxidant enzyme activity (superoxide dismutase and catalase) similar to TR. Muscle damage (creatine kinase) and inflammation (myeloperoxidase) were not reduced by TER. In conclusion, we suggest that TER improves mitochondrial function but does not reduce oxidative stress, muscle damage, or inflammation induced by eccentric contractions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to evaluate cardiorespiratory fitness and pulmonary function and the relationship with metabolic variables and C-reactive protein (CRP) plasma levels in individuals with diabetes mellitus (DM). Nineteen men with diabetes and 19 age- and gender-matched control subjects were studied. All individuals were given incremental cardiopulmonary exercise and pulmonary function tests. In the exercise test, maximal workload (158.3±22.3vs 135.1±25.2, P=0.005), peak heart rate (HRpeak: 149±12 vs 139±10, P=0.009), peak oxygen uptake (VO2peak: 24.2±3.2 vs18.9±2.8, P<0.001), and anaerobic threshold (VO2VT: 14.1±3.4 vs 12.2±2.2, P=0.04) were significantly lower in individuals with diabetes than in control subjects. Pulmonary function test parameters, blood pressure, lipid profile (triglycerides, HDL, LDL, and total cholesterol), and CRP plasma levels were not different in control subjects and individuals with DM. No correlations were observed between hemoglobin A1C (HbA1c), CRP and pulmonary function test and cardiopulmonary exercise test performance. In conclusion, the results demonstrate that nonsmoking individuals with DM have decreased cardiorespiratory fitness that is not correlated with resting pulmonary function parameters, HbA1c, and CRP plasma levels.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The monoamine serotonin (5-hydroxytryptamine, 5-HT), a well-known neurotransmitter, also has important functions outside the central nervous system. The objective of this study was to investigate the role of 5-HT in the proliferation, differentiation, and function of osteoblasts in vitro. We treated rat primary calvarial osteoblasts with various concentrations of 5-HT (1 nM to 10 µM) and assessed the rate of osteoblast proliferation, expression levels of osteoblast-specific proteins and genes, and the ability to form mineralized nodules. Next, we detected which 5-HT receptor subtypes were expressed in rat osteoblasts at different stages of osteoblast differentiation. We found that 5-HT could inhibit osteoblast proliferation, differentiation, and mineralization at low concentrations, but this inhibitory effect was mitigated at relatively high concentrations. Six of the 5-HT receptor subtypes (5-HT1A, 5-HT1B, 5-HT1D, 5-HT2A, 5-HT2B, and 5-HT2C) were found to exist in rat osteoblasts. Of these, 5-HT2A and 5-HT1Breceptors had the highest expression levels, at both early and late stages of differentiation. Our results indicated that 5-HT can regulate osteoblast proliferation and function in vitro.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.