Hepatocyte growth factor (HGF) protects c-met-expressing Burkitt''s lymphoma cell lines from apoptotic death induced by DNA damaging agents

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

3D Curvature Contrast - a geometric or brightness illusion?

Simultaneous contrast effects have been found across a wide range of visual dimensions. We describe a simultaneous contrast effect - three-dimensional curvature contrast - in which the apparent curvature of a surface defined by shading and texture information is influenced by the curvature of a surrounding surface. The effect is strong and easily measurable. We asked whether the effect depends upon the presence of contrast at the level of the internal representation of surface curvature or whether it could be better explained in terms of local changes in the apparent brightness of regions within the test patches induced by luminance transition at the borders. The experimental results suggest that, whicle these luminance-contrast-induced effects do contribute to the observed changes in perceived curvature, there are additional influences. In particular changes in perceived curvature induced by a pattern of curved patches were eliminated or considerably weakened when the inducing pattern was transformed into a photographic negative, a procedure which disrupts the apparent three-dimensional structure of the surface patches without changing their brightness contrast. This suggests a component of the illusion involves comparisons at the level of representation of surface curvature. The observation that three-dimensional curvature contrast presists when the inducing surfaces are spatially separate from the test surface suggests that shape perception involves global, as well as local, operations.

BRCA1 Functions as a Differential Modulator of Chemotherapy-induced Apoptosis

We have evaluated the role played by BRCA1 in mediating the phenotypic response to a range of chemotherapeutic agents commonly used in cancer treatment. Here we provide evidence that BRCA1 functions as a differential mediator of chemotherapy-induced apoptosis. Specifically, we demonstrate that BRCA1 mediates sensitivity to apoptosis induced by antimicrotubule agents but conversely induces resistance to DNA-damaging agents. These data are supported by a variety of experimental models including cells with inducible expression of BRCA1, siRNA-mediated inactivation of endogenous BRCA1, and reconstitution of BRCA1-deficient cells with wild-type BRCA1. Most notably we demonstrate that BRCA1 induces a 10–1000-fold increase in resistance to a range of DNA-damaging agents, in particular those that give rise to double-strand breaks such as etoposide or bleomycin. In contrast, BRCA1 induces a >1000-fold increase in sensitivity to the spindle poisons, paclitaxel and vinorelbine. Fluorescence-activated cell sorter analysis demonstrated that BRCA1 mediates G2/M arrest in response to both antimicrotubule and DNA-damaging agents. However, poly(ADP-ribose) polymerase and caspase-3 cleavage assays indicate that the differential effect mediated by BRCA1 in response to these agents occurs through the inhibition or induction of apoptosis. Therefore, our data suggest that BRCA1 acts as a differential modulator of apoptosis depending on the nature of the cellular insult.

The Role of Thymidylate Synthase Induction in Modulating p53-regulated Gene Expression in Response to 5-Fluorouracil and Antifolates

Thymidylate synthase (TS) is a critical target for chemotherapeutic agents such as 5-fluorouracil (5-FU) and antifolates such as tomudex (TDX),multitargeted antifolate, and ZD9331. Using the MCF-7 breast cancer line, we have developed p53 wild-type (M7TS90) and null (M7TS90-E6) isogenic lines with inducible TS expression (approximately 6-fold induction compared with control after 48 h). In the M7TS90 line, inducible TS expression resulted in a moderate approximately 3-fold increase in 5-FU IC-50(72 h) dose and a dramatic >20-fold increase in the IC-50(72 h) doses of TDX, multitargeted antifolate, and ZD9331. S-phase cell cycle arrest and apoptosis induced by the antifolates were abrogated by TS induction. In contrast, cell cycle arrest and apoptosis induced by 5-FU was unaffected by TS expression levels. Inactivation of p53 significantly increased resistance to 5-FU and the antifolates with IC-50(72 h) doses for 5-FU and TDX of >100 and >10 microM, respectively, in the M7TS90-E6 cell line. Furthermore, p53 inactivation completely abrogated the cell cycle arrest and apoptosis induced by 5-FU. The antifolates induced S-phase arrest in the p53 null cell line; however, the induction of apoptosis by these agents was significantly reduced compared with p53 wild-type cells. Both inducible TS expression and the addition of exogenous thymidine (10 microM) blocked p53 and p21 induction by the antifolates but not by 5-FU in the M7TS90 cell line. Similarly, inducible TS expression and exogenous thymidine abrogated antifolate but not 5-FU-mediated up-regulation of Fas/CD95 in M7TS90 cells. Our results indicate that in M7TS90 cells, inducible TS expression modulates p53 and p53 target gene expression in response to TS-targeted antifolate therapies but not to 5-FU.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.