Anxiety-like symptoms induced by morphine withdrawal may be due to the sensitization of the dorsal periaqueductal grey

Withdrawal from morphine leads to the appearance of extreme anxiety accompanied of several physical disturbances, most of them linked to the activation of brainstem regions such as the locus coeruleus, ventral tegmental area, hypothalamic nuclei and periaqueductal grey (PAG). As anxiety remains one of the main components of morphine withdrawal the present study aimed to evaluating the influence of the dorsal aspects of the PAG on the production of this state, since this structure is well-known to be involved in defensive behaviour elicited by anxiety-evoking stimuli. Different groups of animals were submitted to 10 days of i.p. morphine injections, challenged 2 h after with an i.p. injection of naloxone (0.1 mg/kg), and submitted to the plus-maze, open-field and light-dark transition tests. The effects of morphine withdrawal on anxiety-induced Fos immunolabelling were evaluated in four animals that passed by the light-dark transition test randomly chosen for Fos-protein analysis. Besides the PAG, Fos neural expression was conducted in other brain regions involved in the expression of anxiety-related behaviours. Our results showed that morphine withdrawn rats presented enhanced anxiety accompanied of few somatic symptoms. Increased Fos immunolabelling was noted in brain regions well-known to modulate these states as the prelimbic cortex, nucleus accumbens, amygdala and paraventricular hypothalamus. Increased Fos labelling was also observed in the ventral and dorsal aspects of the PAG, a region involved in anxiety-related processes suggesting that this region could be a common neural substrate enlisted during anxiety evoked by dangerous stimuli as well as those elicited by opiate withdrawal. (c) 2008 Elsevier Inc. All rights reserved,

Contextual politics of service delivery reforms: Lessons from Delhi, Mexico city and Sao Paulo comparison

Little attention has been given to the contextual politics of service delivery reforms. By focusing on cases of reform in the healthcare sector and, to a lesser extent, in the main policies in the social service sector in India, Mexico and Brazil, this article explores two dimensions of analysis which have enormous relevance in understanding the reach and effectiveness of service delivery reforms: (1) the historical timing of reforms and sectorial baselines, and (2) the degree and institutional locus of local discretion in policy. Findings show that depending on both dimensions, there is an extraordinary variation as to the degree, interests involved and meaning of changes which, in theory, correspond to these countries` commitment to the service delivery reforms, However, consideration of the contextual politics is relevant not for the sake of diversity but for the similarities that this diversity reveals, pointing to underlying analytic dimensions that receive attention in this article.

GIGYF2 mutations are not a frequent cause of familial Parkinson`s disease

Mutations in the Grb10-interacting GYF protein 2 (GIGYF2) gene, within the PARK11 locus, have been nominated as a cause of Parkinson`s disease in Italian and French populations. By sequencing the whole GIGYF2 coding region in forty-six probands (thirty-seven Italians) with familial Parkinson`s disease compatible with an autosomal dominant inheritance, we identified no mutations. Our data add to a growing body of evidence suggesting that GIGYF2 mutations are not a frequent cause of PD. (C) 2009 Elsevier Ltd. All rights reserved.

Effects of Perilipin (PLIN) Gene Variation on Metabolic Syndrome Risk and Weight Loss in Obese Children and Adolescents

Context: Genetic polymorphisms at the perilipin (PLIN) locus have been investigated for their potential utility as markers for obesity and metabolic syndrome (MS). We examined in obese children and adolescents (OCA) aged 7-14 yr the association of single-nucleotide polymorphisms (SNP) at the PLIN locus with anthropometric, metabolic traits, and weight loss after 20-wk multi-disciplinary behavioral and nutritional treatment without medication. Design: A total of 234 OCA [body mass index (BMI = 30.4 +/- 4.4 kg/m(2); BMI Z-score = 2.31 +/- 0.4) were evaluated at baseline and after intervention. We genotyped four SNPs (PLIN1 6209T -> C, PLIN4 11482G -> A, PLIN5 13041A -> G, and PLIN6 14995A -> T). Results: Allele frequencies were similar to other populations, PLIN1 and PLIN4 were in linkage disequilibrium (D` = 0.999; P < 0.001). At baseline, no anthropometric differences were observed, but minor allele A at PLIN4 was associated with higher triglycerides (111 +/- 49 vs. 94 +/- 42 mg/dl; P = 0.003), lower high-density lipoprotein cholesterol (40 +/- 9 vs. 44 +/- 10 mg/dl; P = 0.003) and higher homeostasis model assessment for insulin resistance (4.0 +/- 2.3 vs. 3.5 +/- 2.1; P +/- 0.015). Minor allele A at PLIN4 was associated with MS risk (age and sex adjusted) hazard ratio 2.4 (95% confidence interval = 1.1-4.9) for genotype GA and 3.5 (95% confidence interval = 1.2-9.9) for AA. After intervention, subjects carrying minor allele T at PLIN6 had increased weight loss (3.3 +/- 3.7 vs. 1.9 +/- 3.4 kg; P = 0.002) and increased loss of the BMI Z-score (0.23 +/- 0.18 vs. 0.18 +/- 0.15; P +/- 0.003). Due to group size, risk of by-chance findings cannot be excluded. Conclusion: The minor A allele at PLIN4 was associated with higher risk of MS at baseline, whereas the PLIN6 SNP was associated with better weight loss, suggesting that these polymorphisms may predict outcome strategies based on multidisciplinary treatment for OCA. (J Clin Endocrinol Metab 93: 4933-4940, 2008)

Limited ecoclinal variation found in Malva parviflora (small-flowered mallow) across the Mediterranean-climatic agricultural region of Western Australia

Malva parviflora L. populations were collected from 24 locations across the Mediterranean-climatic agricultural region of Western Australia and grown in Perth in a common garden experiment. Seventeen morphometric and taxonomic measurements were taken and genetic variation was investigated by performing principal components analysis (PCA). Taxonomic measurements confirmed that all plants used in the study were M. parviflora. Greater variation occurred within populations than between populations. Separation between populations was only evident between northern and southern populations along principal components 2 (PC2), which was due mainly to flowering time. Flowering time and consequently photoperiod were highly correlated with latitude and regression analysis revealed a close relationship (r(2) = 0.6). Additionally, the pollination system of M. parviflora was examined. Plants were able to self-pollinate without the need for external vectors and the pollen ovule ratio (31 +/- 1.3) revealed that M. parviflora is most likely to be an obligate inbreeder with a slight potential for outcrossing. The limited variation of M. parviflora enhances the likelihood of suitable control strategies being effective across a broad area.

Two distinct regions in 2q24.2-q24.3 associated with idiopathic epilepsy

P>Approximately 50% of all carriers of 2q21-q31 deletions present epileptic seizures. The band 2q24 constitutes the smallest commonly deleted segment in these patients, and contains the voltage-gated sodium channel genes SCN1A and SCN2A, associated with Dravet syndrome and benign familial neonatal-infantile seizures, respectively. A further putative locus involving epilepsy in the region was previously identified through disruption of the SLC4A10 gene by translocation. In the course of performing high-resolution DNA copy number analyses on syndromic mentally impaired individuals, we encountered three patients with overlapping deletions in chromosome region 2q24. Two of these patients exhibited epileptic seizures in addition to mental deficiency. The deletion in one of the epileptic patients did not include the SCN cluster, demonstrating that a less severe form of epilepsy maps to an adjacent genomic region. This second region comprises about 3 Mb and contains the candidate gene SLC4A10, providing further support for the potential role of this gene in epilepsy.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Meta-analysis of the association of 4 angiotensinogen polymorphisms with essential hypertension - A role beyond M235T?

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.

NKX2.5 mutations in patients with non-syndromic congenital heart disease

Background: Cardiac development is a complex and multifactorial biological process. Heterozygous mutations in the transcription factor NKX2.5 are between the first evidence of a genetic cause for congenital heart defects in human beings. In this study, we evaluated the presence and frequency of mutations in the NKX2.5 gene on 159 unrelated patients with a diverse range of non-syndromic congenital heart defects (conotruncal anomalies, septal defects, left-sided lesions, right-sided lesions, patent ductus arteriosus and Ebstein`s anomaly). Methods: The coding region of the NKX2.5 locus was amplified by polymerase chain reaction and mutational analysis was performed using denaturing high performance liquid chromatography (DHPLC) and DNA sequencing. Results: We identified two distinct mutations in the NKX2.5 coding region among the 159 (1.26%) individuals evaluated. An Arg25Cys mutation was identified in a patient with Tetralogy of Fallot. The second mutation found was an Ala42Pro in a patient with Ebstein`s anomaly. Conclusions: The association of NKX2.5 mutations is present in a small percentage of patients with non-syndromic congenital heart defects and may explain only a few cases of the disease. Screening strategies considering the identification of germ-line molecular defects in congenital heart disease are still unwarranted and should consider other genes besides NKX2.5. (C) 2008 Elsevier Ireland Ltd. All rights reserved.

Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR

Aneas I, Rodrigues MV, Pauletti BA, Silva GJ, Carmona R, Cardoso L, Kwitek AE, Jacob HJ, Soler JM, Krieger JE. Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR. Physiol Genomics 37: 52-57, 2009. First published January 6, 2009; doi: 10.1152/physiolgenomics.90299.2008. - To dissect the genetic architecture controlling blood pressure (BP) regulation in the spontaneously hypertensive rat (SHR) we derived congenic rat strains for four previously mapped BP quantitative trait loci (QTLs) in chromosomes 2, 4, and 16. Target chromosomal regions from the Brown Norway rat (BN) averaging 13 - 29 cM were introgressed by marker-assisted breeding onto the SHR genome in 12 or 13 generations. Under normal salt intake, QTLs on chromosomes 2a, 2c, and 4 were associated with significant changes in systolic BP (13, 20, and 15 mmHg, respectively), whereas the QTL on chromosome 16 had no measurable effect. On high salt intake (1% NaCl in drinking water for 2 wk), the chromosome 16 QTL had a marked impact on SBP, as did the QTLs on chromosome 2a and 2c (18, 17, and 19 mmHg, respectively), but not the QTL on chromosome 4. Thus these four QTLs affected BP phenotypes differently: 1) in the presence of high salt intake (chromosome 16), 2) only associated with normal salt intake (chromosome 4), and 3) regardless of salt intake (chromosome 2c and 2a). Moreover, salt sensitivity was abrogated in congenics SHR. BN2a and SHR. BN16. Finally, we provide evidence for the influence of genetic background on the expression of the mapped QTLs individually or as a group. Collectively, these data reveal previously unsuspected nuances of the physiological roles of each of the four mapped BP QTLs in the SHR under basal and/or salt loading conditions unforeseen by the analysis of the F2 cross.

Population structure of Phytophthora cinnamomi in South Africa

Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.