938 resultados para Electro-reológicos


Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVES This study sought to evaluate the relationship between fibrosis imaged by delayed-enhancement (DE) magnetic resonance imaging (MRI) and atrial electrograms (Egms) in persistent atrial fibrillation (AF). BACKGROUND Atrial fractionated Egms are strongly related to slow anisotropic conduction. Their relationship to atrial fibrosis has not yet been investigated. METHODS Atrial high-resolution MRI of 18 patients with persistent AF (11 long-lasting persistent AF) was registered with mapping geometry (NavX electro-anatomical system (version 8.0, St. Jude Medical, St. Paul, Minnesota)). DE areas were categorized as dense or patchy, depending on their DE content. Left atrial Egms during AF were acquired using a high-density, 20-pole catheter (514 ± 77 sites/map). Fractionation, organization/regularity, local mean cycle length (CL), and voltage were analyzed with regard to DE. RESULTS Patients with long-lasting persistent versus persistent AF had larger left atrial (LA) surface area (134 ± 38 cm(2) vs. 98 ± 9 cm(2), p = 0.02), a higher amount of atrial DE (70 ± 16 cm(2) vs. 49 ± 10 cm(2), p = 0.01), more complex fractionated atrial Egm (CFAE) extent (54 ± 16 cm(2) vs. 28 ± 15 cm(2), p = 0.02), and a shorter baseline AF CL (147 ± 10 ms vs. 182 ± 14 ms, p = 0.01). Continuous CFAE (CFEmean [NavX algorithm that quantifies Egm fractionation] <80 ms) occupied 38 ± 19% of total LA surface area. Dense DE was detected at the left posterior left atrium. In contrast, the right posterior left atrium contained predominantly patchy DE. Most CFAE (48 ± 14%) occurred at non-DE LA sites, followed by 41 ± 12% CFAE at patchy DE and 11 ± 6% at dense DE regions (p = 0.005 and p = 0.008, respectively); 19 ± 6% CFAE sites occurred at border zones of dense DE. Egms were less fractionated, with longer CL and lower voltage at dense DE versus non-DE regions: CFEmean: 97 ms versus 76 ms, p < 0.0001; local CL: 153 ms versus 143 ms, p < 0.0001; mean voltage: 0.63 mV versus 0.86 mV, p < 0.0001. CONCLUSIONS Atrial fibrosis as defined by DE MRI is associated with slower and more organized electrical activity but with lower voltage than healthy atrial areas. Ninety percent of continuous CFAE sites occur at non-DE and patchy DE LA sites. These findings are important when choosing the ablation strategy in persistent AF.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neurodegeneration in Parkinson's disease dementia (PDD) and dementia with Lewy bodies (DLB) affect cortical and subcortical networks involved in saccade generation. We therefore expected impairments in saccade performance in both disorders. In order to improve the pathophysiological understanding and to investigate the usefulness of saccades for differential diagnosis, saccades were tested in age- and education-matched patients with PDD (n = 20) and DLB (n = 20), Alzheimer's disease (n = 22) and Parkinson's disease (n = 24), and controls (n = 24). Reflexive (gap, overlap) and complex saccades (prediction, decision and antisaccade) were tested with electro-oculography. PDD and DLB patients had similar impairment in all tasks (P > 0.05, not significant). Compared with controls, they were impaired in both reflexive saccade execution (gap and overlap latencies, P < 0.0001; gains, P < 0.004) and complex saccade performance (target prediction, P < 0.0001; error decisions, P < 0.003; error antisaccades: P < 0.0001). Patients with Alzheimer's disease were only impaired in complex saccade performance (Alzheimer's disease versus controls, target prediction P < 0.001, error decisions P < 0.0001, error antisaccades P < 0.0001), but not reflexive saccade execution (for all, P > 0.05). Patients with Parkinson's disease had, compared with controls, similar complex saccade performance (for all, P > 0.05) and only minimal impairment in reflexive tasks, i.e. hypometric gain in the gap task (P = 0.04). Impaired saccade execution in reflexive tasks allowed discrimination between DLB versus Alzheimer's disease (sensitivity > or =60%, specificity > or =77%) and between PDD versus Parkinson's disease (sensitivity > or =60%, specificity > or =88%) when +/-1.5 standard deviations was used for group discrimination. We conclude that impairments in reflexive saccades may be helpful for differential diagnosis and are minimal when either cortical (Alzheimer's disease) or nigrostriatal neurodegeneration (Parkinson's disease) exists solely; however, they become prominent with combined cortical and subcortical neurodegeneration in PDD and DLB. The similarities in saccade performance in PDD and DLB underline the overlap between these conditions and underscore differences from Alzheimer's disease and Parkinson's disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Traditionally, ontologies describe knowledge representation in a denotational, formalized, and deductive way. In addition, in this paper, we propose a semiotic, inductive, and approximate approach to ontology creation. We define a conceptual framework, a semantics extraction algorithm, and a first proof of concept applying the algorithm to a small set of Wikipedia documents. Intended as an extension to the prevailing top-down ontologies, we introduce an inductive fuzzy grassroots ontology, which organizes itself organically from existing natural language Web content. Using inductive and approximate reasoning to reflect the natural way in which knowledge is processed, the ontology’s bottom-up build process creates emergent semantics learned from the Web. By this means, the ontology acts as a hub for computing with words described in natural language. For Web users, the structural semantics are visualized as inductive fuzzy cognitive maps, allowing an initial form of intelligence amplification. Eventually, we present an implementation of our inductive fuzzy grassroots ontology Thus,this paper contributes an algorithm for the extraction of fuzzy grassroots ontologies from Web data by inductive fuzzy classification.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The geometric characterization of low-voltage dielectric electro-active polymer (EAP) structures, comprised of nanometer thickness but areas of square centimeters, for applications such as artificial sphincters requires methods with nanometer precision. Direct optical detection is usually restricted to sub-micrometer resolution because of the wavelength of the light applied. Therefore, we propose to take advantage of the cantilever bending system with optical readout revealing a sub-micrometer resolution at the deflection of the free end. It is demonstrated that this approach allows us to detect bending of rather conventional planar asymmetric, dielectric EAP-structures applying voltages well below 10 V. For this purpose, we built 100 μm-thin silicone films between 50 nm-thin silver layers on a 25 μm-thin polyetheretherketone (PEEK) substrate. The increase of the applied voltage in steps of 50 V until 1 kV resulted in a cantilever bending that exhibits only in restricted ranges the expected square dependence. The mean laser beam displacement on the detector corresponded to 6 nm per volt. The apparatus will therefore become a powerful mean to analyze and thereby improve low-voltage dielectric EAP-structures to realize nanometer-thin layers for stack actuators to be incorporated into artificial sphincter systems for treating severe urinary and fecal incontinence.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND "The feeling of being there" is one possible way to describe the phenomenon of feeling present in a virtual environment and to act as if this environment is real. One brain area, which is hypothesized to be critically involved in modulating this feeling (also called presence) is the dorso-lateral prefrontal cortex (dlPFC), an area also associated with the control of impulsive behavior. METHODS In our experiment we applied transcranial direct current stimulation (tDCS) to the right dlPFC in order to modulate the experience of presence while watching a virtual roller coaster ride. During the ride we also registered electro-dermal activity. Subjects also performed a test measuring impulsiveness and answered a questionnaire about their presence feeling while they were exposed to the virtual roller coaster scenario. RESULTS Application of cathodal tDCS to the right dlPFC while subjects were exposed to a virtual roller coaster scenario modulates the electrodermal response to the virtual reality stimulus. In addition, measures reflecting impulsiveness were also modulated by application of cathodal tDCS to the right dlPFC. CONCLUSION Modulating the activation with the right dlPFC results in substantial changes in responses of the vegetative nervous system and changed impulsiveness. The effects can be explained by theories discussing the top-down influence of the right dlPFC on the "impulsive system".

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Epileptic seizures of focal origin are classically considered to arise from a focal epileptogenic zone and then spread to other brain regions. This is a key concept for semiological electro-clinical correlations, localization of relevant structural lesions, and selection of patients for epilepsy surgery. Recent development in neuro-imaging and electro-physiology and combinations, thereof, have been validated as contributory tools for focus localization. In parallel, these techniques have revealed that widespread networks of brain regions, rather than a single epileptogenic region, are implicated in focal epileptic activity. Sophisticated multimodal imaging and analysis strategies of brain connectivity patterns have been developed to characterize the spatio-temporal relationships within these networks by combining the strength of both techniques to optimize spatial and temporal resolution with whole-brain coverage and directional connectivity. In this paper, we review the potential clinical contribution of these functional mapping techniques as well as invasive electrophysiology in human beings and animal models for characterizing network connectivity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A direct electron transfer process between bacterial cells of electrogenic species Geobacter sulfurreducens (Gs) and electrified electrode surfaces was studied to exploit the reactivity of Gs submonolayers on gold and silver surfaces. A submonolayer of Gs was prepared and studied to explore specifically the heterogeneous electron transfer properties at the bacteria/electrode interface. In situ microscopic techniques characterised the morphology of the Gs submonolayers under the operating conditions. In addition, complementary in situ spectroscopic techniques that allowed us to access in situ molecular information of the Gs with high surface selectivity and sensitivity were employed. The results provided clear evidence that the outermost cytochrome C in Gs is responsible for the heterogeneous electron transfer, which is in direct contact with the metal electrode. Feasibility of single cell in situ studies under operating conditions was demonstrated where the combination of surface-electrochemical tools at the nano- and micro-scale with microbiological approaches can offer unique opportunities for the emerging field of electro-microbiology to explore processes and interactions between microorganisms and electrical devices.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We present an experimental study of the CO electro-oxidation on Pt(100)-(1 × 1) electrodes employing electrochemical methods in combination with in situ scanning tunneling microscopy (STM) and shell-isolated nanoparticle enhanced Raman spectroscopy (SHINERS). We discussed the nature and stability of the active sites in the preignition region in the presence of dissolved CO (COb) and monitored substrate structure changes during the COb electro-oxidation process. We corroborated that the electro-oxidation kinetics is determined decisively by the history of CO adlayer formation. A new mechanism was proposed for Pt(100) electrode deactivation in the preignition region after excursion of electrode potential to COb ignition region. We believe that this mechanism takes place on Pt surfaces independently on their crystallographic orientation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Essential amino acids cannot be synthesized by humans and animals. They often are limiting in plant-derived foods and determine the nutritional value of a given diet [1]. Seeds and fruits often represent the harvestable portion of plants. In order to improve the amino acid composition of these tissues, it is indispensable to understand how these substrates are transported within the plant. Amino acids result from nitrogen assimilation, which often occurs in leaves, the source tissue. They are transported via the vasculature, the xylem, and the phloem into the seeds, the so-called sink tissue, where they are stored or consumed. In seeds, several tissues are symplasmically isolated [2, 3], i.e., not connected by plasmodesmata, channels in the cell walls that enable a cytoplasmic continuum in plants [4]. Consequently, amino acids must be exported from cells into the apoplast and re-imported many times to support seed development. Several amino acid importers are known, but exporters remained elusive [5, 6]. Here, we characterize four members of the plant-specific UmamiT transporter family from Arabidopsis, related to the amino acid facilitator SIAR1 and the vacuolar auxin transporter WAT1 [7, 8]. We show that the proteins transport amino acids along their (electro)chemical potential across the plasma membrane. In seeds, they are found in tissues from which amino acids are exported. Loss-of-function mutants accumulate high levels of free amino acids in fruits and produce smaller seeds. Our results strongly suggest a crucial role for the UmamiTs in amino acid export and possibly a means to improve yield quality.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Detecting lame cows is important in improving animal welfare. Automated tools are potentially useful to enable identification and monitoring of lame cows. The goals of this study were to evaluate the suitability of various physiological and behavioral parameters to automatically detect lameness in dairy cows housed in a cubicle barn. Lame cows suffering from a claw horn lesion (sole ulcer or white line disease) of one claw of the same hind limb (n=32; group L) and 10 nonlame healthy cows (group C) were included in this study. Lying and standing behavior at night by tridimensional accelerometers, weight distribution between hind limbs by the 4-scale weighing platform, feeding behavior at night by the nose band sensor, and heart activity by the Polar device (Polar Electro Oy, Kempele, Finland) were assessed. Either the entire data set or parts of the data collected over a 48-h period were used for statistical analysis, depending upon the parameter in question. The standing time at night over 12 h and the limb weight ratio (LWR) were significantly higher in group C as compared with group L, whereas the lying time at night over 12 h, the mean limb difference (△weight), and the standard deviation (SD) of the weight applied on the limb taking less weight were significantly lower in group C as compared with group L. No significant difference was noted between the groups for the parameters of heart activity and feeding behavior at night. The locomotion score of cows in group L was positively correlated with the lying time and △weight, whereas it was negatively correlated with LWR and SD. The highest sensitivity (0.97) for lameness detection was found for the parameter SD [specificity of 0.80 and an area under the curve (AUC) of 0.84]. The highest specificity (0.90) for lameness detection was present for Δweight (sensitivity=0.78; AUC=0.88) and LWR (sensitivity=0.81; AUC=0.87). The model considering the data of SD together with lying time at night was the best predictor of cows being lame, accounting for 40% of the variation in the likelihood of a cow being lame (sensitivity=0.94; specificity=0.80; AUC=0.86). In conclusion, the data derived from the 4-scale-weighing platform, either alone or combined with the lying time at night over 12 h, represent the most valuable parameters for automated identification of lame cows suffering from a claw horn lesion of one individual hind limb.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Section "A": Dissecting and Post-Mortem Instruments Diagnostic Instruments and Apparatus Microscopes and Microscopic Accessories Laboratory Apparatus and Glass Ware Apparatus for Blood and Urine Analysis Apparatus for Phlebotomy, Cupping and Leeching Apparatus for Infusion and Transfusion Syringes for Aspiration and Injection Osteological Preparations Section "B": Anaesthetic, General Operating, Osteotomy, Trepanning, Bullet, Pocket Case, Cautery, Ligatures, Sutures, Dressings, Etc. Section "B" continued Section "C": Eye, Ear, Nasal, Dermal, Oral, Tonsil, Tracheal, Laryngeal,Esophageal, Stomach, Intestinal, Gall Bladder Section "C": continued Section "D": Rectal, Phimosis, Prostatic, Vesical, Urethral, Ureteral, Instruments Section "E": Gynecic, Hysterectomy, Obstetrical, Instrument Satchels, Medicine Cases Section "F": Electric Cautery Transformers, Electro-Cautery Burners and Accessories, Electric Current Controllers, Electro-Diagnostic Outfits, Electrolysis Instruments Electro-Therapeutic Lamps, Faradic Batteries, Galvanic Batteries Section "G": Office Furniture, Office Sterilizing Apparatus, Hospital Supplies, Surgical Rubber Goods, Sick Room Utensils, Invalid Rolling Chairs, Invalid Supplies Section "H": Artificial Limbs, Deformity Apparatus, Fracture Apparatus, Splints, Splint Material, Elastic Hosiery, Abdominal Supporters, Crutches, Trusses, Suspensories, Etc. Index

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Tyrosine hydroxylase (TH) expression increases in adrenal chromaffin cells treated with the nicotinic agonist, dimethylphenylpiperazinium (DMPP; 1 μM). We are using this response as a model of the changes in TH level that occur during increased cholinergic neural activity. Here we report a 4-fold increase in TH mRNA half-life in DMPP-treated chromaffin cells that is apparent when using a pulse-chase analysis to measure TH mRNA half-life. No increase is apparent using actinomycin D to measure half-life, indicating a requirement for ongoing transcription. Characterization of protein binding to the TH 3′UTR using RNA electro-mobility shift assays show the presence of two complexes both of which are increased by DMPP-treatment. The faster migrating complex (FMC) increases 2.5-fold and the slower migrating complex (SMC) increases 1.5-fold. Separation of UV crosslinked RNA-protein complexes on SDS polyacrylamide gels shows FMC to contain a single protein whereas SMC contains two proteins. Northwesterns yielded similar results. Transfection studies reveal an increase in expression of the full-length TH transcript due to DMPP-treatment similar to that of endogenous TH mRNA. This finding suggests the increased expression is due primarily to mRNA stabilization. Transfection of luciferase reporter constructs containing regions of the TH 3′UTR reveal only the full-length 3′UTR influenced the expression level of reporter transcripts. ^