Spatial organization of nucleotide excision repair proteins after UV-induced DNA damage in the human cell nucleus.

Nucleotide excision repair (NER) is an evolutionary conserved DNA repair system that is essential for the removal of UV-induced DNA damage. In this study we investigated how NER is compartmentalized in the interphase nucleus of human cells at the ultrastructural level by using electron microscopy in combination with immunogold labeling. We analyzed the role of two nuclear compartments: condensed chromatin domains and the perichromatin region. The latter contains transcriptionally active and partly decondensed chromatin at the surface of condensed chromatin domains. We studied the distribution of the damage-recognition protein XPC and of XPA, which is a central component of the chromatin-associated NER complex. Both XPC and XPA rapidly accumulate in the perichromatin region after UV irradiation, whereas only XPC is also moderately enriched in condensed chromatin domains. These observations suggest that DNA damage is detected by XPC throughout condensed chromatin domains, whereas DNA-repair complexes seem preferentially assembled in the perichromatin region. We propose that UV-damaged DNA inside condensed chromatin domains is relocated to the perichromatin region, similar to what has been shown for DNA replication. In support of this, we provide evidence that UV-damaged chromatin domains undergo expansion, which might facilitate the translocation process. Our results offer novel insight into the dynamic spatial organization of DNA repair in the human cell nucleus.

Chromosomal versus mitochondrial DNA evolution: tracking the evolutionary history of the southwestern european populations of the Sorex araneus group (Mammalia Insectivora)

The shrews of the Sorer araneus group have undergone a spectacular chromosome evolution. The karyotype of Sorer granarius is generally considered ancestral to those of Sorer coronatus and S. araneus. However, a sequence of 777 base pairs of the cytochrome b gene of the mitochondrial DNA (mtDNA) produces a quite different picture: S. granarius is closely related to the populations of S. araneus from the Pyrenees and from the northwestern Alps, whereas S. coronatus and S. araneus from Italy and the southern Alps represent two well-separated lineages. It is suggested that mtDNA and chromosomal evolution are in this case largely independant processes. Whereas mtDNA haplotypes are closely linked to the geographical history of the populations, chromosomal mutations were probably transmitted from one population to another. Available data suggest that the impressive chromosome polymorphism of this group is quite a recent phenomenon.

Optimal priming of poxvirus vector (NYVAC)-based HIV vaccine regimens requires 3 DNA injections. Results of the EV03/ANRS Vac20 Phase I/II Trial

Background: Two or three DNA primes have been used in previous smaller clinical trials, but the number required for optimal priming of viral vectors has never been assessed in adequately powered clinical trials. The EV03/ANRS Vac20 phase I/II trial investigated this issue using the DNA prime/poxvirus NYVAC boost combination, both expressing a common HIV-1 clade C immunogen consisting of Env and Gag-Pol-Nef polypeptide. Methods: 147 healthy volunteers were randomly allocated through 8 European centres to either 3xDNA plus 1xNYVAC (weeks 0, 4, 8 plus 24; n¼74) or to 2xDNA plus 2xNYVAC (weeks 0, 4 plus 20, 24; n¼73), stratified by geographical region and sex. T cell responses were quantified using the interferon g Elispot assay and 8 peptide pools; samples from weeks 0, 26 and 28 (time points for primary immunogenicity endpoint), 48 and 72 were considered for this analysis. Results: 140 of 147 participants were evaluable at weeks 26 and/ or 28. 64/70 (91%) in the 3xDNA arm compared to 56/70 (80%) in the 2xDNA arm developed a T cell response (P¼0.053). 26 (37%) participants of the 3xDNA arm developed a broader T cell response (Env plus at least to one of the Gag, Pol, Nef peptide pools) versus 15 (22%) in the 2xDNA arm (P¼0.047). At week 26, the overall magnitude of responses was also higher in the 3xDNA than in the 2xDNA arm (similar at week 28), with a median of 545 versus 328 SFUs/106 cells at week 26 (P<0.001). Preliminary overall evaluation showed that participants still developed T-cell response at weeks 48 (78%, n¼67) and 72 (70%, n¼66). Conclusion: This large clinical trial demonstrates that optimal priming of poxvirus-based vaccine regimens requires 3 DNA regimens and further confirms that the DNA/NYVAC prime boost vaccine combination is highly immunogenic and induced durable T-cell responses.

The DNA repair protein ALKBH2 mediates temozolomide resistance in human glioblastoma cells.

INTRODUCTION: Glioblastoma multiforme (GBM; World Health Organization astrocytoma grade IV) is the most frequent and most malignant primary brain tumor in adults. Despite multimodal therapy, all such tumors practically recur during the course of therapy, causing a median survival of only 14.6 months in patients with newly diagnosed GBM. The present study was aimed at examining the expression of the DNA repair protein AlkB homolog 2 (ALKBH2) in human GBM and determining whether it could promote resistance to temozolomide chemotherapy. METHODS: ALKBH2 expression in GBM cell lines and in human GBM was determined by quantitative real-time PCR (qRT-PCR) and gene expression analysis, respectively. Drug sensitivity was assessed in GBM cells overexpressing ALKBH2 and in cells in which ALKBH2 expression was silenced by small-interfering (si)RNA. ALKBH2 expression following activation of the p53 pathway was examined by western blotting and qRT-PCR. RESULTS: ALKBH2 was abundantly expressed in established GBM cell lines and human GBM, and temozolomide exposure increased cellular ALKBH2 expression levels. Overexpression of ALKBH2 in the U87 and U251 GBM cell lines enhanced resistance to the methylating agents temozolomide and methyl methanesulfonate but not to the nonmethylating agent doxorubicin. Conversely, siRNA-mediated knockdown of ALKBH2 increased sensitivity of GBM cells to temozolomide and methyl methanesulfonate but not to doxorubicin or cisplatin. Nongenotoxic activation of the p53 pathway by the selective murine double minute 2 antagonist nutlin-3 caused a significant decrease in cellular ALKBH2 transcription levels. CONCLUSION: Our findings identify ALKBH2 as a novel mediator of temozolomide resistance in human GBM cells. Furthermore, we place ALKBH2 into a new cellular context by showing its regulation by the p53 pathway.

The estrogen-responsive element as an inducible enhancer: DNA sequence requirements and conversion to a glucocorticoid-responsive element.

The estrogen-responsive element (ERE) present in the 5'-flanking region of the Xenopus laevis vitellogenin (vit) gene B1 has been characterized by transient expression analysis of chimeric vit-tk-CAT (chloramphenicol acetyltransferase) gene constructs transfected into the human estrogen-responsive MCF-7 cell line. The vit B1 ERE behaves like an inducible enhancer, since it is able to confer estrogen inducibility to the heterologous HSV thymidine kinase (tk) promoter in a relative position- and orientation-independent manner. In this assay, the minimal B1 ERE is 33 bp long and consists of two 13 bp imperfect palindromic elements both of which are required for the enhancer activity. A third imperfect palindromic element is present further upstream within the 5'-flanking region of the gene but is unable to confer hormone responsiveness by itself. Similarly, neither element forming the B1 ERE can alone confer estrogen inducibility to the tk promoter. However, in combinations of two, all three imperfect palindromes can act cooperatively to form a functional ERE. In contrast a single 13 bp perfect palindromic element, GGTCACTGTGACC, such as the one found upstream of the vit gene A2, is itself sufficient to act as a fully active ERE. Single point mutations within this element abolish estrogen inducibility, while a defined combination of two mutations converts this ERE into a glucocorticoid-responsive element.

Biological embedding of early-life exposures and disease risk in humans : a role for DNA methylation

BACKGROUND: Following wider acceptance of 'the thrifty phenotype' hypothesis and the convincing evidence that early-life exposures can influence adult health even decades after the exposure, much interest has been placed on the mechanisms through which early-life exposures become biologically embedded. MATERIALS AND METHODS: In this review, we summarize the current literature regarding biological embedding of early-life experiences. To this end, we conducted a literature search to identify studies investigating early-life exposures in relation to DNA methylation changes. In addition, we summarize the challenges faced in investigations of epigenetic effects, stemming from the peculiarities of this emergent and complex field. A proper systematic review and meta-analyses were not feasible given the nature of the evidence. RESULTS: We identified seven studies on early-life socio-economic circumstances, 10 studies on childhood obesity and six studies on early-life nutrition all relating to DNA methylation changes that met the stipulated inclusion criteria. The pool of evidence gathered, albeit small, favours a role of epigenetics and DNA methylation in biological embedding, but replication of findings, multiple comparison corrections, publication bias and causality are concerns remaining to be addressed in future investigations. CONCLUSIONS: Based on these results, we hypothesize that epigenetics, in particular DNA methylation, is a plausible mechanism through which early-life exposures are biologically embedded. This review describes the current status of the field and acts as a stepping stone for future, better designed investigations on how early-life exposures might become biologically embedded through epigenetic effects.

The Bacillus subtilis bacteriophage SPP1 G39P delivers and activates the G40P DNA helicase upon interacting with the G38P-bound replication origin.

Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.

Phylogeography and Pleistocene refugia of the adder (Vipera berus) as inferred from mitochondrial DNA sequence data.

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

DNA ja koulukirjat vielä kerran

Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.

Siihen aikaan kun DNA lukion biologian kirjoihin tuli

Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004

DNA ja Helsingin geneetikot

Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin

Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma.

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Current directions in DNA gel particles

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.