986 resultados para Dimethyl sulfoxide
Resumo:
We used coincident Envisat RA2 and AATSR temperature and wind speed data from 2008/2009 to calculate the global net sea-air flux of dimethyl sulfide (DMS), which we estimate to be 19.6 Tg S a21. Our monthly flux calculations are compared to open ocean eddy correlation measurements of DMS flux from 10 recent cruises, with a root mean square difference of 3.1 lmol m22 day21. In a sensitivity analysis, we varied temperature, salinity, surface wind speed, and aqueous DMS concentration, using fixed global changes as well as CMIP5 model output. The range of DMS flux in future climate scenarios is discussed. The CMIP5 model predicts a reduction in surface wind speed and we estimate that this will decrease the global annual sea-air flux of DMS by 22% over 25 years. Concurrent changes in temperature, salinity, and DMS concentration increase the global flux by much smaller amounts. The net effect of all CMIP5 modelled 25 year predictions was a 19% reduction in global DMS flux. 25 year DMS concentration changes had significant regional effects, some positive (Southern Ocean, North Atlantic, Northwest Pacific) and some negative (isolated regions along the Equator and in the Indian Ocean). Using satellite-detected coverage of coccolithophore blooms, our estimate of their contribution to North Atlantic DMS emissions suggests that the coccolithophores contribute only a small percentage of the North Atlantic annual flux estimate, but may be more important in the summertime and in the northeast Atlantic.
Resumo:
The air-sea fluxes of methanol and acetone were measured concurrently using a proton-transfer-reaction mass spectrometer (PTR-MS) with the eddy covariance (EC) technique during the High Wind Gas Exchange Study (HiWinGS) in 2013. The seawater concentrations of these compounds were also measured twice daily with the same PTR-MS coupled to a membrane inlet. Dissolved concentrations near the surface ranged from 7 to 28 nM for methanol and from 3 to 9 nM for acetone. Both gases were consistently transported from the atmosphere to the ocean as a result of their low sea surface saturations. The largest influxes were observed in regions of high atmospheric concentrations and strong winds (up to 25 m s(-1)). Comparison of the total air-sea transfer velocity of these two gases (K-a), along with the in situ sensible heat transfer rate, allows us to constrain the individual gas transfer velocity in the air phase (k(a)) and water phase (k(w)). Among existing parameterizations, the scaling of k(a) from the COARE model is the most consistent with our observations. The k(w) we estimated is comparable to the tangential (shear driven) transfer velocity previously determined from measurements of dimethyl sulfide. Lastly, we estimate the wet deposition of methanol and acetone in our study region and evaluate the lifetimes of these compounds in the surface ocean and lower atmosphere with respect to total (dry plus wet) atmospheric deposition.
Resumo:
Este trabajo revisa la evolución y estado actual de la automoción eléctrica; analiza las ventajas ambientales, de eficiencia energética y de costes del motor eléctrico frente al de combustión interna; y presenta como limitaciones para el uso del vehículo eléctrico, el desarrollo actual de las baterías recargables y la lenta implantación de electrolineras. Con el objetivo de contribuir al desarrollo de una actividad económica respetuosa con el medio ambiente y basada en nuevas tecnologías, se proyecta, a partir de experiencias previas, una instalación de puntos de recarga para una ciudad de 50.000 habitantes con un parque de 100 vehículos eléctricos que dispone de dos plazas de recarga rápida (poste trifásico 400V CA), siete plazas de recarga lenta (postes monofásicos 230V CA) y de 50 módulos fotovoltaicos que producen diariamente la energía equivalente a la recarga lenta de un vehículo en los meses fríos y de dos en los meses cálidos.
Resumo:
NMR studies were conducted with the aim of determining the diastereoisomeric ratio of a commercially supplied sample of mesoridazine (MES) and to compare the results with a freshly synthesised sample of MES. The results indicated that the commercially supplied MES consisted almost entirely of one diastereoisomeric pair, which was in agreement with previous findings reported by Eap et al. (J Chromatogr 669:271-279, 1995). The synthesised sample of MES was analysed by NMR in two stages: 1) as the initial product isolated as the free base from the direct synthesis, and 2) as the free base isolated from the crystallised besylate salt of the synthetic product. The NMR results show that the initial synthetic product consisted of two equal pairs of diastereoisomers. The diastereoisomeric pairs were further separated by the addition of the chiral shift reagent (R)-(-)-N-(3,5 dinitrobenzoyl)-alpha-benzylamine to reveal equal quantities of all four enantiomers, clearly observed at the methyl sulfoxide proton peak of the NMR scan. The sample obtained from the crystallisation of MES besylate, however, indicated a significant difference, with a diastereoisomeric ratio of 75:25. The results suggest that MES besylate undergoes preferential crystallisation of one pair of diastereoisomers, with the other pair remaining in solution. (C) 2004 Wiley-Liss, Inc.
Resumo:
The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Ab initio molecular dynamics simulations have been performed for the first time on the room-temperature organic ionic liquid dimethyl imidazolium chloride [DMIM][Cl] using density functional theory. The aim is to compare the local liquid structure with both that obtained from two different classical force fields and from neutron scattering experiments. The local structure around the cation shows significant differences compared to both the classical calculations and the neutron results. In particular, and unlike in the gas-phase ion pair, chloride ions tend to be located near a ring C-H proton in a position suggesting hydrogen bonding. The results are used to suggest ways in which the classical potentials may be improved.
Resumo:
Epoxides and phosphites are often used as additives to stabilize the properties of polymers, including bisphenol A polycarbonate (BPA-PC). We describe density functional (DF) calculations of the reactions of cyclohexene oxide (CHO, cyclohexane epoxide) and phosphites with chain segments of BPA-PC, with the aim of identifying possible reaction paths and energy barriers. The reactions of CHO with the OH-terminated PC chains and with the carbonate group are exothermic, although there is an energy barrier in each case of more than 10 kcal/mol. A comparison of results for different CHO isomers demonstrates the importance of steric effects. The reactions between the same groups of the PC chain and the phosphites 2-[2,4-bis(tert-butyl)phenoxy]-5,5-dimethyl-1,3,2-dioxaphosphorinane] (BPDD) and trimethyl phosphite (TMP), and their phosphonate isomers are characterized by large energy barriers.
Resumo:
Ab initio simulations of a single molecule of HCl in liquid dimethyl imidazolium chloride [dmim][Cl] show that the acidic proton exists as a symmetric, linear ClHCl- species. Details of the solvation structure around this molecule are given. The proton-transfer process was investigated by applying a force along the antisymmetric stretch coordinate until the molecule broke. Changes in the free energy and local solvation structure during this process were investigated. In the reaction mechanism identified, a free chloride approaches the proton from the side. As the original ClHCl- distorts and the incoming chloride forms a new bond to the proton, one of the original chlorine atoms is expelled and a new linear molecule is formed.
Resumo:
We have analysed the electronic wave functions from an ab initio simulation of the ionic liquid (room temperature molten salt) dimethyl imidazolium chloride ([dmim][Cl] or [C1mim][Cl]) using localized Wannier orbitals. This allows us to assign electron density to individual ions. The probability distributions of the ionic dipole moments for an isolated ion and for ions in solution are compared. The liquid environment is found to polarize the cation by about 0.7 D and to increase the amplitude of the fluctuations in the dipole moments of both cation and anion. The relative changes in nuclear and electronic contributions are shown. The implications for classical force fields are discussed.
Resumo:
The production of an antibody to detect toltrazuril or its metabolite ponazuril is complicated due to structural constraints of conjugating these coccidiostats to a carrier protein. Therefore a search was carried out for a compound that shared a common substructure to use as an antigen mimic. The chosen compound, trifluoraminoether, was conjugated to two carrier proteins (HSA and BTG) and used in the immunisation of six rabbits. Two immunogen doses (1 mg and 0.1 mg) were also used. All six rabbits produced an immunological response to the hapten regardless of the carrier protein or immunogen dose used. The most sensitive polyclonal antibody produced, designated R609, was subsequently characterised. This antiserum exhibited an IC50 of 18 ng ml-1 using a competitive ELISA format. Cross reactivity studies show that this serum is specific for toltrazuril and its metabolites (toltrazuril sulfoxide and toltrazuril sulfone) but does not cross-react with other coccidiostats such as halofuginone, nitroimidazoles or nicarbazin. This is the first reported production of an antibody capable of specifically binding toltrazuril and ponazuril.
Resumo:
NMR studies were conducted with the aim of determining the diastereoisomeric ratio of a commercially supplied sample of mesoridazine (MES) and to compare the results with a freshly synthesised sample of MES. The results indicated that the commercially supplied MES consisted almost entirely of one diastereoisomeric pair, which was in agreement with previous findings reported by Eap et al. (J Chromatogr 669:271-279, 1995). The synthesised sample of MES was analysed by NMR in two stages: 1) as the initial product isolated as the free base from the direct synthesis, and 2) as the free base isolated from the crystallised besylate salt of the synthetic product. The NMR results show that the initial synthetic product consisted of two equal pairs of diastereoisomers. The diastereoisomeric pairs were further separated by the addition of the chiral shift reagent (R)-(-)-N-(3,5 dinitrobenzoyl)-alpha-benzylamine to reveal equal quantities of all four enantiomers, clearly observed at the methyl sulfoxide proton peak of the NMR scan. The sample obtained from the crystallisation of MES besylate, however, indicated a significant difference, with a diastereoisomeric ratio of 75:25. The results suggest that MES besylate undergoes preferential crystallisation of one pair of diastereoisomers, with the other pair remaining in solution. (C) 2004 Wiley-Liss, Inc.
Resumo:
A one-electron oxidation of a methionine residue is thought to be a key step in the neurotoxicity of the beta amyloid peptide of Alzheimer's disease. The chemistry of the radical cation of N-formylmethioninamide (11+) and two model systems, dimethyl sulfide (1+) and ethyl methyl sulfide (6+), in the presence of oxygen have been studied by B3LYP/6-31G(d) and CBS-RAD calculations. The stable form of 11+ has a three-electron bond between the sulfur radical cation and the carbonyl oxygen atom of the i - 1 residue. The radical cation may lose a proton from the methyl or methylene groups flanking the oxidized sulfur. Both 11+ and the resultant C-centered radicals may add oxygen to form peroxy radicals. The calculations indicate that unlike C-centered radicals the sulfur radical cation does not form a covalent bond to oxygen but rather forms a loose ion-induced dipole complex with an S-O separation of about 2.7 Å, and is bound by about 13 kJ mol-1 (on the basis of 1+ + O2). Direct intramolecular abstraction of an H atom from the C site is unlikely. It is endothermic by more than 20 kJ mol-1 and involves a high barrier (G = 79 kJ mol-1). The -to-S C-centered radicals will add oxygen to form peroxy radicals. The OH BDEs of the parent hydroperoxides are in the range of 352-355 kJ mol-1, similar to SH BDEs (360 kJ mol-1) and C-H BDEs (345-350 kJ mol-1). Thus, the peroxy radicals are oxidizing species comparable in strength to thiyl radicals and peptide backbone C-centered radicals. Each peroxy radical can abstract a hydrogen atom from the backbone C site of the Met residue to yield the corresponding C-centered radical/hydroperoxide in a weakly exothermic process with modest barriers in the range of 64-92 kJ mol-1.
Resumo:
Radiotherapy is an important treatment for patients suffering from high-grade malignant gliomas. Non-targeted (bystander) effects may influence these cells' response to radiation and the investigation of these effects may therefore provide new insights into mechanisms of radiosensitivity and responses to radiotherapy as well as define new targets for therapeutic approaches. Normal primary human astrocytes (NHA) and T98G glioma cells were irradiated with helium ions using the Gray Cancer Institute microbeam facility targeting individual cells. Irradiated NHA and T98G glioma cells generated signals that induced gammaH2AX foci in neighbouring non-targeted bystander cells up to 48 h after irradiation. gammaH2AX bystander foci were also observed in co-cultures targeting either NHA or T98G cells and in medium transfer experiments. Dimethyl sulphoxide, Filipin and anti-transforming growth factor (TGF)-beta 1 could suppress gammaH2AX foci in bystander cells, confirming that reactive oxygen species (ROS) and membrane-mediated signals are involved in the bystander signalling pathways. Also, TGF-beta 1 induced gammaH2AX in an ROS-dependent manner similar to bystander foci. ROS and membrane signalling-dependent differences in bystander foci induction between T98G glioma cells and normal human astrocytes have been observed. Inhibition of ataxia telangiectasia mutated (ATM) protein and DNA-PK could not suppress the induction of bystander gammaH2AX foci whereas the mutation of ATM- and rad3-related (ATR) abrogated bystander foci induction. Furthermore, ATR-dependent bystander foci induction was restricted to S-phase cells. These observations may provide additional therapeutic targets for the exploitation of the bystander effect.
Resumo:
Non-ideal behaviour of 1-butyl-3-methylimidazolium hexafluorophosphate [bmim][PF6] in ethylene glycol monomethyl ether; CH3OCH2CH2OH (EGMME), ethylene glycol dimethyl ether; CH3OCH2CH2OCH3 (EGDME) and diethylene glycol dimethyl ether; CH3(OCH2CH2)2OCH3 (DEGDME) have been investigated over the whole composition range at T = (298.15 to 318.15) K. To gain insight into the mixing behaviour, results of density measurements were used to estimate excess molar volumes, image, apparent molar volumes, Vphi,i, partial molar volumes, image, excess partial molar volumes, image, and their limiting values at infinite dilution, image, image, and image, respectively. Volumetric results have been analyzed in the light of Prigogine–Flory–Patterson (PFP) statistical mechanical theory. Measurements of refractive indices n were also performed for all the binary mixtures over whole composition range at T = 298.15 K. Deviations in refractive indices ?phin and the deviation of molar refraction ?xR have been calculated from experimental data. Refractive indices results have been correlated with volumetric results and have been interpreted in terms of molecular interactions. Excess properties are fitted to the Redlich–Kister polynomial equation to obtain the binary coefficients and the standard errors.