Air-sea exchange of methanol and acetone during HiWinGS: Estimation of air phase, water phase gas transfer velocities

The air-sea fluxes of methanol and acetone were measured concurrently using a proton-transfer-reaction mass spectrometer (PTR-MS) with the eddy covariance (EC) technique during the High Wind Gas Exchange Study (HiWinGS) in 2013. The seawater concentrations of these compounds were also measured twice daily with the same PTR-MS coupled to a membrane inlet. Dissolved concentrations near the surface ranged from 7 to 28 nM for methanol and from 3 to 9 nM for acetone. Both gases were consistently transported from the atmosphere to the ocean as a result of their low sea surface saturations. The largest influxes were observed in regions of high atmospheric concentrations and strong winds (up to 25 m s(-1)). Comparison of the total air-sea transfer velocity of these two gases (K-a), along with the in situ sensible heat transfer rate, allows us to constrain the individual gas transfer velocity in the air phase (k(a)) and water phase (k(w)). Among existing parameterizations, the scaling of k(a) from the COARE model is the most consistent with our observations. The k(w) we estimated is comparable to the tangential (shear driven) transfer velocity previously determined from measurements of dimethyl sulfide. Lastly, we estimate the wet deposition of methanol and acetone in our study region and evaluate the lifetimes of these compounds in the surface ocean and lower atmosphere with respect to total (dry plus wet) atmospheric deposition.

Las infraestructuras de recarga y el despegue del vehículo eléctrico.

Este trabajo revisa la evolución y estado actual de la automoción eléctrica; analiza las ventajas ambientales, de eficiencia energética y de costes del motor eléctrico frente al de combustión interna; y presenta como limitaciones para el uso del vehículo eléctrico, el desarrollo actual de las baterías recargables y la lenta implantación de electrolineras. Con el objetivo de contribuir al desarrollo de una actividad económica respetuosa con el medio ambiente y basada en nuevas tecnologías, se proyecta, a partir de experiencias previas, una instalación de puntos de recarga para una ciudad de 50.000 habitantes con un parque de 100 vehículos eléctricos que dispone de dos plazas de recarga rápida (poste trifásico 400V CA), siete plazas de recarga lenta (postes monofásicos 230V CA) y de 50 módulos fotovoltaicos que producen diariamente la energía equivalente a la recarga lenta de un vehículo en los meses fríos y de dos en los meses cálidos.

Effects of diphosphine structure on aurophilicity and luminescence in Au(I) complexes

The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Physicochemical and mineralogical characteristics of soil/saprolite cores from a field research site, Tennessee

Site characterization is an essential initial step in determining the feasibility of remedial alternatives at hazardous waste sites. Physicochemical and mineralogical characterization of U-contaminated soils in deeply weathered saprolite at Area 2 of the DOE Field Research Center (FRC) site, Oak Ridge, TN, was accomplished to examine the feasibility of bioremediation. Concentrations of U in soil–saprolite (up to 291 mg kg–1 in oxalate-extractable Uo) were closely related to low pH (ca. 4–5), high effective cation exchange capacity without Ca (64.7–83.2 cmolc kg–1), amorphous Mn content (up to 9910 mg kg–1), and the decreased presence of relative clay mineral contents in the bulk samples (i.e., illite 2.5–12 wt. %, average 32 wt. %). The pH of the fill material ranged from 7.0 to 10.5, whereas the pH of the saprolite ranged from 4.5 to 8. Uranium concentration was highest (about 300 mg kg–1) at around 6 m below land surface near the saprolite–fill interface. The pH of ground water at Area 2 tended to be between 6 and 7 with U concentrations of about 0.9 to 1.7 mg L–1. These site specific characteristics of Area 2, which has lower U and nitrate contamination levels and more neutral ground water pH compared with FRC Areas 1 and 3 (ca. 5.5 and

Ab initio molecular dynamics simulation of a room temperature ionic liquid

Ab initio molecular dynamics simulations have been performed for the first time on the room-temperature organic ionic liquid dimethyl imidazolium chloride [DMIM][Cl] using density functional theory. The aim is to compare the local liquid structure with both that obtained from two different classical force fields and from neutron scattering experiments. The local structure around the cation shows significant differences compared to both the classical calculations and the neutron results. In particular, and unlike in the gas-phase ion pair, chloride ions tend to be located near a ring C-H proton in a position suggesting hydrogen bonding. The results are used to suggest ways in which the classical potentials may be improved.

Reactions of polycarbonate with cyclohexene oxide and phosphites: A density functional study

Epoxides and phosphites are often used as additives to stabilize the properties of polymers, including bisphenol A polycarbonate (BPA-PC). We describe density functional (DF) calculations of the reactions of cyclohexene oxide (CHO, cyclohexane epoxide) and phosphites with chain segments of BPA-PC, with the aim of identifying possible reaction paths and energy barriers. The reactions of CHO with the OH-terminated PC chains and with the carbonate group are exothermic, although there is an energy barrier in each case of more than 10 kcal/mol. A comparison of results for different CHO isomers demonstrates the importance of steric effects. The reactions between the same groups of the PC chain and the phosphites 2-[2,4-bis(tert-butyl)phenoxy]-5,5-dimethyl-1,3,2-dioxaphosphorinane] (BPDD) and trimethyl phosphite (TMP), and their phosphonate isomers are characterized by large energy barriers.

Solvation Structure and Transport of Acidic Protons in Ionic Liquids: A First-principles Simulation Study

Ab initio simulations of a single molecule of HCl in liquid dimethyl imidazolium chloride [dmim][Cl] show that the acidic proton exists as a symmetric, linear ClHCl- species. Details of the solvation structure around this molecule are given. The proton-transfer process was investigated by applying a force along the antisymmetric stretch coordinate until the molecule broke. Changes in the free energy and local solvation structure during this process were investigated. In the reaction mechanism identified, a free chloride approaches the proton from the side. As the original ClHCl- distorts and the incoming chloride forms a new bond to the proton, one of the original chlorine atoms is expelled and a new linear molecule is formed.

Molecular electrostatic properties of ions in an ionic liquid

We have analysed the electronic wave functions from an ab initio simulation of the ionic liquid (room temperature molten salt) dimethyl imidazolium chloride ([dmim][Cl] or [C1mim][Cl]) using localized Wannier orbitals. This allows us to assign electron density to individual ions. The probability distributions of the ionic dipole moments for an isolated ion and for ions in solution are compared. The liquid environment is found to polarize the cation by about 0.7 D and to increase the amplitude of the fluctuations in the dipole moments of both cation and anion. The relative changes in nuclear and electronic contributions are shown. The implications for classical force fields are discussed.

Structure and kinetics of phosphonopyruvate hydrolase from Variovorax sp. Pal2: New insight into the divergence of catalysis within the PEP mutase/isocitrate lyase superfamily .

Phosphonopyruvate (P-pyr) hydrolase (PPH), a member of the phosphoenolpyruvate (PEP) mutase/isocitrate lyase (PEPM/ICL) superfamily, hydrolyzes P-pyr and shares the highest sequence identity and functional similarity with PEPM. Recombinant PPH from Variovorax sp. Pal2 was expressed in Escherichia coli and purified to homogeneity. Analytical gel filtration indicated that the protein exists in solution predominantly as a tetramer. The PPH pH rate profile indicates maximal activity over a broad pH range.The steady-state kinetic constants determined for a rapid equilibrium ordered kinetic mechanism with Mg+2 binding first (Kd =140 ± 40 M), are kcat = 105 ± 2 s-1 and P-pyr Km = 5 ± 1 M. PEP (slow substrate kcat = 2 × 10-4 s-1), oxalate, and sulfopyruvate are competitive inhibitors with Ki values of 2.0 ± 0.1 mM, 17 ± 1 M, and 210 ± 10 M, respectively. Three PPH crystal structures have been determined, that of a ligand-free enzyme, the enzyme bound to Mg2+ and oxalate (inhibitor), and the enzyme bound to Mg2+ and P-pyr (substrate). The complex with the inhibitor was obtained by cocrystallization, whereas that with the substrate was obtained by briefly soaking crystals of the ligand-free enzyme with P-pyr prior to flash cooling. The PPH structure resembles that of the other members of the PEPM/ICL superfamily and is most similar to the functionally related enzyme, PEPM. Each monomer of the dimer of dimers exhibits an (/)8 barrel fold with the eighth helix swapped between two molecules of the dimer. Both P-pyr and oxalate are anchored to the active site by Mg2+. The loop capping the active site is disordered in all three structures, in contrast to PEPM, where the equivalent loop adopts an open or disordered conformation in the unbound state but sequesters the inhibitor from solvent in the bound state. Crystal packing may have favored the open conformation of PPH even when the enzyme was cocrystallized with the oxalate inhibitor. Structure alignment of PPH with other superfamily members revealed two pairs of invariant or conservatively replaced residues that anchor the flexible gating loop. The proposed PPH catalytic mechanism is analogous to that of PEPM but includes activation of a water nucleophile with the loop Thr118 residue.

Reactions of One-Electron-Oxidized Methionine with Oxygen: An ab initio study

A one-electron oxidation of a methionine residue is thought to be a key step in the neurotoxicity of the beta amyloid peptide of Alzheimer's disease. The chemistry of the radical cation of N-formylmethioninamide (11+) and two model systems, dimethyl sulfide (1+) and ethyl methyl sulfide (6+), in the presence of oxygen have been studied by B3LYP/6-31G(d) and CBS-RAD calculations. The stable form of 11+ has a three-electron bond between the sulfur radical cation and the carbonyl oxygen atom of the i - 1 residue. The radical cation may lose a proton from the methyl or methylene groups flanking the oxidized sulfur. Both 11+ and the resultant C-centered radicals may add oxygen to form peroxy radicals. The calculations indicate that unlike C-centered radicals the sulfur radical cation does not form a covalent bond to oxygen but rather forms a loose ion-induced dipole complex with an S-O separation of about 2.7 Å, and is bound by about 13 kJ mol-1 (on the basis of 1+ + O2). Direct intramolecular abstraction of an H atom from the C site is unlikely. It is endothermic by more than 20 kJ mol-1 and involves a high barrier (G = 79 kJ mol-1). The -to-S C-centered radicals will add oxygen to form peroxy radicals. The OH BDEs of the parent hydroperoxides are in the range of 352-355 kJ mol-1, similar to SH BDEs (360 kJ mol-1) and C-H BDEs (345-350 kJ mol-1). Thus, the peroxy radicals are oxidizing species comparable in strength to thiyl radicals and peptide backbone C-centered radicals. Each peroxy radical can abstract a hydrogen atom from the backbone C site of the Met residue to yield the corresponding C-centered radical/hydroperoxide in a weakly exothermic process with modest barriers in the range of 64-92 kJ mol-1.

ATR-dependent radiation-induced gammaH2AX foci in bystander primary human astrocytes and glioma cells.

Radiotherapy is an important treatment for patients suffering from high-grade malignant gliomas. Non-targeted (bystander) effects may influence these cells' response to radiation and the investigation of these effects may therefore provide new insights into mechanisms of radiosensitivity and responses to radiotherapy as well as define new targets for therapeutic approaches. Normal primary human astrocytes (NHA) and T98G glioma cells were irradiated with helium ions using the Gray Cancer Institute microbeam facility targeting individual cells. Irradiated NHA and T98G glioma cells generated signals that induced gammaH2AX foci in neighbouring non-targeted bystander cells up to 48 h after irradiation. gammaH2AX bystander foci were also observed in co-cultures targeting either NHA or T98G cells and in medium transfer experiments. Dimethyl sulphoxide, Filipin and anti-transforming growth factor (TGF)-beta 1 could suppress gammaH2AX foci in bystander cells, confirming that reactive oxygen species (ROS) and membrane-mediated signals are involved in the bystander signalling pathways. Also, TGF-beta 1 induced gammaH2AX in an ROS-dependent manner similar to bystander foci. ROS and membrane signalling-dependent differences in bystander foci induction between T98G glioma cells and normal human astrocytes have been observed. Inhibition of ataxia telangiectasia mutated (ATM) protein and DNA-PK could not suppress the induction of bystander gammaH2AX foci whereas the mutation of ATM- and rad3-related (ATR) abrogated bystander foci induction. Furthermore, ATR-dependent bystander foci induction was restricted to S-phase cells. These observations may provide additional therapeutic targets for the exploitation of the bystander effect.

Non-ideal behaviour of a room temperature ionic liquid in an alkoxyethanol or poly ethers at T = (298.15 to 318.15) K

Non-ideal behaviour of 1-butyl-3-methylimidazolium hexafluorophosphate [bmim][PF6] in ethylene glycol monomethyl ether; CH3OCH2CH2OH (EGMME), ethylene glycol dimethyl ether; CH3OCH2CH2OCH3 (EGDME) and diethylene glycol dimethyl ether; CH3(OCH2CH2)2OCH3 (DEGDME) have been investigated over the whole composition range at T = (298.15 to 318.15) K. To gain insight into the mixing behaviour, results of density measurements were used to estimate excess molar volumes, image, apparent molar volumes, Vphi,i, partial molar volumes, image, excess partial molar volumes, image, and their limiting values at infinite dilution, image, image, and image, respectively. Volumetric results have been analyzed in the light of Prigogine–Flory–Patterson (PFP) statistical mechanical theory. Measurements of refractive indices n were also performed for all the binary mixtures over whole composition range at T = 298.15 K. Deviations in refractive indices ?phin and the deviation of molar refraction ?xR have been calculated from experimental data. Refractive indices results have been correlated with volumetric results and have been interpreted in terms of molecular interactions. Excess properties are fitted to the Redlich–Kister polynomial equation to obtain the binary coefficients and the standard errors.

Stereoselective reductase-catalysed deoxygenation of sulfoxides in aerobic and anaerobic bacteria

Direct and indirect evidence, Of unexpected stereoselective reductase-catalysed deoxygenations of sulfoxides, was found. The deoxygenations proceeded simultaneously, with the expected dioxygenase-catalysed asymmetric sulfoxidation of sulfides, during some biotransformations with the aerobic bacterium Pseudomonas putida UV4. Stereoselective reductase-catalysed asymmetric deoxygenation of racemic alkylaryl, dialkyl and phenolic sulfoxides was observed, without evidence of the reverse sulfoxidation reaction, using anaerobic bacterial strains. A purified dimethyl sulfoxide reductase, obtained from the intact cells of the anaerobic bacterium Citrobacter braakii DMSO 11, yielded, from the corresponding racemates, enantiopure alkylaryl sulfoxide and thiosulfinate samples.

Effect of cultivar and storage time on the volatile flavor components of baked potato

Tubers of five cultivars of potato were stored at 4 degreesC for 2 3 and 8 months and baked in a conventional oven The flavor compounds from the baked potato flesh were isolated by headspace adsorption onto Tenax and analyzed by gas chromatography-mass spectrometry On a quantitative basis compounds derived from lipid and Maillard reaction/sugar degradation dominated the flavor isolates with sulfur compounds, methoxypyrazines, and terpenes making smaller contributions Levels of 37 of the > 150 detected compounds were monitored in each cultivar with time of storage Many significant differences were found in levels of individual compounds compound classes and total monitored compounds for the individual effects of cultivar and storage time and for their two way interaction Differences may be explained by variations in levels of flavor precursors and activities of enzymes mediating flavor compound formation among cultivars and storage times In addition differences in agronomic conditions may partly account for variations among cultivars Overall of the compounds monitored those most likely having the greatest flavor impact were 2-isopropyl 3 methyoxypyrazine 2 isobutyl 3-methoxypyrazine dimethyl trisulfide, decanal and 3 methylbutanal, with methylpropanal, 2 methylbutanal methional, and nonanal also being probable important contributors to flavor.