Wing polymorphism and dispersal of Scaptocoris carvalhoi (Hemiptera : Cydnidae)

Functional wing polymorphism is commonly observed it) insects, and it may confer an important adaptive value to populations that bear this trait, because it allows dispersal and the location to more favorable habitats for their survival and reproduction. According to the oogenesis-flight syndrome theory, such wing polymorphism may imply differences in the locomotion Capacity of individuals, which is a factor induced by adverse environmental conditions during muscle development in immatures. Scaptocoris carvalhoi Becker (Hemiptera: Cydnidae) is an important agriculture pest in Brazil, and it has burrowing habits. The adults swarm in the beginning of the rainy season after a prolonged drought period in the Brazilian cerrado region. In these swarms, part of the population leaves the soil, performing long flights until locations with more abundant vegetation. In this study, we characterized wing polymorphism in S. carvalhoi, this being the first description in a species of Cydnidae. Brachypterous and macropterous males and females were observed, which showed positive and significant correlations between body length and hindwing length. Macropterous individuals demonstrated greater locomotion capacity than brachypterous individuals. In addition, only long-winged adults could fly, showing wing mobility and flight reaction. The increased number of macropterous individuals inside the soil during the swarming season and in the beginning of the rainy period suggests that wing polymorphism in this population occurs in seasonal cycles and that factors related to the scarcity of rains influence the development of immatures and the formation of polymorphic adults.

Extension of the core map of common bean with EST-SSR, RGA, AFLP, and putative functional markers

Microsatellites and gene-derived markers are still underrepresented in the core molecular linkage map of common bean compared to other types of markers. In order to increase the density of the core map, a set of new markers were developed and mapped onto the RIL population derived from the `BAT93` x `Jalo EEP558` cross. The EST-SSR markers were first characterized using a set of 24 bean inbred lines. On average, the polymorphism information content was 0.40 and the mean number of alleles per locus was 2.7. In addition, AFLP and RGA markers based on the NBS-profiling method were developed and a subset of the mapped RGA was sequenced. With the integration of 282 new markers into the common bean core map, we were able to place markers with putative known function in some existing gaps including regions with QTL for resistance to anthracnose and rust. The distribution of the markers over 11 linkage groups is discussed and a newer version of the common bean core linkage map is proposed.

Biotype stability of Candida albicans isolates after culture storage determined by randomly amplified polymorphic DNA and phenotypical methods

P>Typing methods to evaluate isolates in relation to their phenotypical and molecular characteristics are essential in epidemiological studies. In this study, Candida albicans biotypes were determined before and after storage in order to verify their stability. Twenty C. albicans isolates were typed by Randomly Amplified Polymorphic DNA (RAPD), production of phospholipase and proteinase exoenzymes (enzymotyping) and morphotyping before and after 180 days of storage in Sabouraud dextrose agar (SDA) and sterilised distilled water. Before the storage, 19 RAPD patterns, two enzymotypes and eight morphotypes were identified. The fragment patterns obtained by RAPD, on the one hand, were not significantly altered after storage. On the other hand, the majority of the isolates changed their enzymotype and morphotype after storage. RAPD typing provided the better discriminatory index (DI) among isolates (DI = 0.995) and maintained the profile identified, thereby confirming its utility in epidemiological surveys. Based on the low reproducibility observed after storage in SDA and distilled water by morphotyping (DI = 0.853) and enzymotyping (DI = 0.521), the use of these techniques is not recommended on stored isolates.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Matrix metalloproteinase-2 polymorphism is associated with prognosis in prostate cancer

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

The 434(G > C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

Objective: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G > C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic variables. Methods: The ECP genotypes of 165 healthy individuals and 157 OSCC patients were detected by PCR-RFLP analysis after cleavage of the amplified DNA sequence with enzyme PstI. TATE was obtained by morphometric analysis. Chi-square test or Fisher`s exact test was used to analyze the association of ECP-gene polymorphism 434(G > C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test. Results: Most of healthy individuals (53.33%) and OSCC patients (57.97%) were heterozygous for the ECP 434(G > C) polymorphism. Based on numerical differences, our results showed that OSCC patients with intense TATE and at least one C allele had a higher frequency of bilateral neck dissection, local recurrence, vascular embolization, involved resection margins, and postoperative radiotherapy. No statistically significant differences on survival rates were found in OSCC patients presenting different ECP 434(G > C) genotypes. Conclusions: These results suggest a tendency towards a poor clinical outcome in OSCC patients with intense TATE and 434GC/CC genotypes, probably due to an ECP genetic variant with altered cytotoxic activity.

Identification of an apolipoprotein(e) variant associated with type III hyperlipoproteinaemia in an indigenous Australian

As a result of testing for lipid and apolipoprotein(e) (apo E) phenotype status of an indigenous Australian community, an apo E variant associated with type III hyperlipoproteinaemia has been identified. Apo E phenotype was determined by analysis of VLDL by isoelectric focusing, and genotype on DNA amplified by polymerase chain reaction, using two different restriction enzyme isotyping assays. Phenotypes and genotypes were discordant in samples from two subjects and an abnormal-sized restriction fragment was also observed in their genotyping gel patterns. DNA sequencing studies revealed this was due to a single nucleotide deletion. 3817delC, at amino acid 136 on apo E. This resulted in a new reading frame and the premature termination of the apo E protein due to a stop codon (TGA) at nucleotide 4105. The variant apo E null allele showed a recessive mode of inheritance and, in combination with the E2 allele, resulted in the type III hyperlipoproteinaemic phenotype but when inherited with the E4 allele had no marked effect on plasma lipids.

Transpecific microsatellites for hard pines M. Shepherd, M. Cross, T. Maguire, M. Dieters, C. Williams, R. Henry

Microsatellites are difficult to recover from large plant genomes so cross-specific utilisation is an important source of markers. Fifty micro satellites were tested for cross-specific amplification and polymorphism to two New World hard pine species, slash pine (Pinus elliottii var. elliottii) and Caribbean pine (R caribaea var. hondurensis). Twenty-nine (58%) markers amplified in both hard pine species, and 23 of these 29 were polymorphic. Soft pine (subgenus Strobus) microsatellite markers did amplify, but none were polymorphic. Pinus elliottii var. elliottii and R caribaea var. hondurensis showed mutational changes in the flanking regions and the repeat motif that were informative for Pinus spp. phylogenetic relationships. Most allele length variation could be attributed to variability in repeat unit number. There was no evidence for ascertainment bias.

Identification of T cell epitopes on the 33-kDa fragment of Plasmodium yoelii merozoite surface protein 1 and their antibody-independent protective role in immunity to blood stage malarial

Merozoite surface protein 1 (MSP1) of malaria parasites undergoes proteolytic processing at least twice before invasion into a new RBC. The 42-kDa fragment, a product of primary processing, is cleaved by proteolytic enzymes giving rise to MSP1(33), which is shed from the merozoite surface, and MSP1(19), which is the only fragment carried into a new RBC. In this study, we have identified T cell epitopes on MSP1(33) of Plasmodium yoelii and have examined their function in immunity to blood stage malaria. Peptides 20 aa in length, spanning the length of MSP1(33) and overlapping each other by 10 aa, were analyzed for their ability to induce T cell proliferation in immunized BALB/c and C57BL/6 mice. Multiple epitopes were recognized by these two strains of mice. Effector functions of the dominant epitopes were then investigated. Peptides Cm15 and Cm21 were of particular interest as they were able to induce effector T cells capable of delaying growth of lethal P. yoelii YM following adoptive transfer into immuno-deficient mice without inducing detectable Ab responses. Homologs of these epitopes could be candidates for inclusion in a subunit vaccine.

XRCC3 THR241MET polymorphism influence on nuclear buds frequency in exposed to formaldehyde

Formaldehyde (FA), also known as formalin, formal and methyl aldehydes, is a colorless, flammable, strong-smelling gas. It has an important application in embalming tissues and that result in exposures for workers in the pathology anatomy laboratories and mortuaries. Occupational exposure to FA has been shown to induce nasopharyngeal cancer and has been classified as carcinogenic to humans (group 1) on the basis of sufficient evidence in humans and sufficient evidence in experimental animals. Manifold in vitro studies clearly indicated that FA is genotoxic. FA induced various genotoxic effects in proliferating cultured mammalian cells. The cytokinesis-block micronucleus (CBMN) assay was originally developped as an ideal system form easuring micronucleus (MN), however it can also be used to measure nucleoplasmic bridges (NBP) and nuclear buds (NBUD). Over the past decade another unique mechanism of micronucleus formation, known as nuclear budding has emerged. NBUDS is considered as a marker of gene amplification and/or altered gene dosage because the nuclear budding process is the mechanism by which cells removed amplified and/excess DNA.

XRCC3241 Polymorphism influence on genotoxicity biomarkers frequency in workers occupationaly exposed to formaldehyde

Formaldehyde (FA) is ubiquitous in the environment and is a chemical agent that possesses high reactivity. Occupational exposure to FA has been shown to induce nasopharyngeal cancer and has been classified as carcinogenic to humans (group 1) on the basis of sufficient evidence in humans and sufficient evidence in experimental animals. The exposure to this substance is epidemiologically linked to cancer and nuclear changes detected by the cytokinesis-block micronucleus test (CBMN). This method is extensively used in molecular epidemiology, since it determines several biomarkers of genotoxicity, such as micronucleus (biomarkers of chromosomes breakage or loss), nucleoplasmic bridges (biomarker of chromosome rearrangement, poor repair and / or telomeres fusion) and nuclear buds (biomarker of elimination of amplified DNA). The gene X-ray repair cross-complementing group 3 (XRCC3) is involved in homologous recombination repair of cross-links and chromosomal double-strand breaks and at least one polymorphism has been reported in codon 241, a substitution of a methionine for a threonine.

Optimization of random amplified polymorphic DNA techniques for use in genetic studies of Cuban triatominae

Random amplified polymorphic DNA (RAPD) technique is a simple and reliable method to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of assay. In this study, we analyzed the effect of changing the concentration of primer, magnesium chloride, template DNA and Taq DNA polymerase with the objective of determining their optimum concentration for the standardization of RAPD technique for genetic studies of Cuban Triatominae. Reproducible amplification patterns were obtained using 5 pmoL of primer, 2.5 mM of MgCl2, 25 ng of template DNA and 2 U of Taq DNA polymerase in 25 µL of the reaction. A panel of five random primers was used to evaluate the genetic variability of T. flavida. Three of these (OPA-1, OPA-2 and OPA-4) generated reproducible and distinguishable fingerprinting patterns of Triatominae. Numerical analysis of 52 RAPD amplified bands generated for all five primers was carried out with unweighted pair group method analysis (UPGMA). Jaccard's Similarity Coefficient data were used to construct a dendrogram. Two groups could be distinguished by RAPD data and these groups coincided with geographic origin, i.e. the populations captured in areas from east and west of Guanahacabibes, Pinar del Río. T. flavida present low interpopulation variability that could result in greater susceptibility to pesticides in control programs. The RAPD protocol and the selected primers are useful for molecular characterization of Cuban Triatominae.

Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi

Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.

Identification and differentiation of Candida species from pediatric patients by random amplified polymorphic DNA

Thirty-four Candida isolates were analyzed by random amplified polymorphic DNA using the primer OPG-10:24 Candida albicans; 4 Candida tropicalis; 2 Candida parapsilosis; 2 Candida dubliniensis; 1 Candida glabrata and 1 Candida krusei. The UPGMA-Pearson correlation coefficient was used to calculate the genetic distance between the different Candida groupings. Samples were classified as identical (correlation of 100%); highly related samples (90%); moderately related samples (80%) and unrelated samples (< 70%). The results showed that the RAPD proposed was capable of classifying the isolates coherently (such that same species were in the same dendrogram), except for two isolates of Candida parapsilosis and the positive control (Netherlands, 1973), probably because they are now recognized as three different species. Concerning the only fluconazole-resistant Candida tropicalis isolate with a genotype that was different to the others, the data were insufficient to affirm that the only difference was the sensitivity to fluconazole. We concluded that the Random Amplified Polymorphic DNA proposed might be used to confirm Candida species identified by microbiological methods.