Analysis of p53 function and regulation

p53 is a tumor suppressor gene that is the most frequent target inactivated in cancers. Overexpression of wild-type p53 in rat embryo fibroblasts suppresses foci formation by other cooperating oncogenes. Introduction of wild-type p53 into cells that lack p53 arrests them at the G1/S boundary and reverses the transformed phenotype of some cells. The function of p53 in normal cells is illustrated by the ability of p53 to arrest cells at G1 phase of the cell cycle upon exposure to DNA-damaging agents including UV-irradiation and biosynthesis inhibitors.^ Since the amino acid sequence of p53 suggested that it may function as a transcription factor, we used GAL4 fusion assays to test that possibility. We found that wild-type p53 could specifically activate transcription when anchored by the GAL4 DNA binding domain. Mutant p53s, which have lost the ability to suppress foci formation by other oncogenes, were not able to activate transcription in this assay. Thus, we established a direct correlation between the tumor suppression and transactivation functions of p53.^ Having learned that p53 was a transcriptional activator, we next sought targets of p53 activation. Because many transcription factors regulate their own expression, we tested whether p53 had this autoregulatory property. Transient expression of wild-type p53 in cells increased the levels of endogenous p53 mRNA. Cotransfection of p53 together with a reporter bearing the p53 promoter confirmed that wild-type p53 specifically activates its own promoter. Deletion analysis from both the 5$\sp\prime$ and 3$\sp\prime$ ends of the promoter minimized the region responsible for p53 autoregulation to 45 bp. Methylation interference identified nucleotides involved in protein-DNA interaction. Mutations within this protected site specifically eliminated the response of the promoter to p53. In addition, multiple copies of this element confer responsiveness to wild-type p53 expression. Thus, we identified a F53 responsive element within the p53 promoter.^ The presence of a consensus NF-$\kappa$B site in the p53 promoter suggested that NF-KB may regulate p53 expression. Gel-shift experiments showed that both the p50 homodimer and the p50/p65 heterodimer bind to the p53 promoter. In addition, the p65 subunit of NF-$\kappa$B activates the p53 promoter in transient transfection experiments. TNF $\alpha$, a natural NF-$\kappa$B inducer, also activates the p53 promoter. Both p65 activation and TNF $\alpha$ induction require an intact NF-$\kappa$B site in the p53 promoter. Since NF-$\kappa$B activation occurs as a response to stress and p53 arrests cells in G1/S, where DNA repair occurs, activation of p53 by NF-$\kappa$B could be a mechanism by which cells recover from stress.^ In conclusion, we provided the first data that wild-type p53 functions as a transcriptional activator, whereas mutant p53 cannot. The correlation between growth suppression and transcriptional activation by p53 implies a pathway of tumor suppression. We have analyzed upstream components of the pathway by the identification of both p53 and NF-$\kappa$B as regulators of the p53 promoter. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

DnaA-stimulated transcriptional activation of oriλ: Escherichia coli RNA polymerase β subunit as a transcriptional activator contact site

We present evidence that Escherichia coli RNA polymerase β subunit may be a transcriptional activator contact site. Stimulation of the activity of the pR promoter by DnaA protein is necessary for replication of plasmids derived from bacteriophage λ. We found that DnaA activates the pR promoter in vitro. Particular mutations in the rpoB gene were able to suppress negative effects that certain dnaA mutations had on the replication of λ plasmids; this suppression was allele-specific. When a potential DnaA-binding sequence located several base pairs downstream of the pR promoter was scrambled by in vitro mutagenesis, the pR promoter was no longer activated by DnaA both in vivo and in vitro. Therefore, we conclude that DnaA may contact the β subunit of RNA polymerase during activation of the pR promoter. A new classification of prokaryotic transcriptional activators is proposed.

Functional copies of a human gene can be directly isolated by transformation-associated recombination cloning with a small 3′ end target sequence

Unique, small sequences (sequence tag sites) have been identified at the 3′ ends of most human genes that serve as landmarks in genome mapping. We investigated whether a single copy gene could be isolated directly from total human DNA by transformation-associated recombination (TAR) cloning in yeast using a short, 3′ unique target. A TAR cloning vector was constructed that, when linearized, contained a small amount (381 bp) of 3′ hypoxanthine phosphoribosyltransferase (HPRT) sequence at one end and an 189-bp Alu repeat at the other end. Transformation with this vector along with human DNA led to selective isolations of the entire HPRT gene as yeast artificial chromosomes (YACs) that extended from the 3′ end sequence to various Alu positions as much as 600 kb upstream. These YACs were retrofitted with a NeoR and a bacterial artificial chromosome (BAC) sequence to transfer the YACs to bacteria and subsequently the BACs to mouse cells by using a Neo selection. Most of the HPRT isolates were functional, demonstrating that TAR cloning retains the functional integrity of the isolated material. Thus, this modified version of TAR cloning, which we refer to as radial TAR cloning, can be used to isolate large segments of the human genome accurately and directly with only a small amount of sequence information.

Requirement of GM2 ganglioside activator for phospholipase D activation

Sequence analysis of a heat-stable protein necessary for the activation of ADP ribosylation factor-dependent phospholipase D (PLD) reveals that this protein has a structure highly homologous to the previously known GM2 ganglioside activator whose deficiency results in the AB-variant of GM2 gangliosidosis. The heat-stable activator protein indeed has the capacity to enhance enzymatic conversion of GM2 to GM3 ganglioside that is catalyzed by β-hexosaminidase A. Inversely, GM2 ganglioside activator purified separately from tissues as described earlier [Conzelmann, E. & Sandhoff, K. (1987) Methods Enzymol. 138, 792–815] stimulates ADP ribosylation factor-dependent PLD in a dose-dependent manner. At higher concentrations of ammonium sulfate, the PLD activator protein apparently substitutes for protein kinase C and phosphatidylinositol 4,5-bisphosphate, both of which are known as effective stimulators of the PLD reaction. The mechanism of action of the heat-stable PLD activator protein remains unknown.

A maize zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the basic leucine zipper transcriptional activator Opaque2

The prolamin box (P-box) is a highly conserved 7-bp sequence element (5′-TGTAAAG-3′) found in the promoters of many cereal seed storage protein genes. Nuclear factors from maize endosperm specifically interact with the P-box present in maize prolamin genes (zeins). The presence of the P-box in all zein gene promoters suggests that interactions between endosperm DNA binding proteins and the P-box may play an important role in the coordinate activation of zein gene expression during endosperm development. We have cloned an endosperm-specific maize cDNA, named prolamin-box binding factor (PBF), that encodes a member of the recently described Dof class of plant Cys2-Cys2 zinc-finger DNA binding proteins. When tested in gel shift assays, PBF exhibits the same sequence-specific binding to the P-box as factors present in maize endosperm nuclei. Additionally, PBF interacts in vitro with the basic leucine zipper protein Opaque2, a known transcriptional activator of zein gene expression whose target site lies 20 bp downstream of the P-box in the 22-kDa zein gene promoter. The isolation of the PBF gene provides an essential tool to further investigate the functional role of the highly conserved P-box in regulating cereal storage protein gene expression.

Upstream A-tracts increase bacterial promoter activity through interactions with the RNA polymerase α subunit

Upstream A-tracts stimulate transcription from a variety of bacterial promoters, and this has been widely attributed to direct effects of the intrinsic curvature of A-tract-containing DNA. In this work we report experiments that suggest a different mechanism for the effects of upstream A-tracts on transcription. The similarity of A-tract-containing sequences to the adenine- and thymine-rich upstream recognition elements (UP elements) found in some bacterial promoters suggested that A-tracts might increase promoter activity by interacting with the α subunit of RNA polymerase (RNAP). We found that an A-tract-containing sequence placed upstream of the Escherichia coli lac or rrnB P1 promoters stimulated transcription both in vivo and in vitro, and that this stimulation required the C-terminal (DNA-binding) domain of the RNAP α subunit. The A-tract sequence was protected by wild-type RNAP but not by α-mutant RNAPs in footprints. The effect of the A-tracts on transcription was not as great as that of the most active UP elements, consistent with the degree of similarity of the A-tract sequence to the UP element consensus. A-tracts functioned best when positioned close to the −35 hexamer rather than one helical turn farther upstream, similar to the positioning optimal for UP element function. We conclude that A-tracts function as UP elements, stimulating transcription by providing binding site(s) for the RNAP αCTD, and we suggest that these interactions could contribute to the previously described wrapping of promoter DNA around RNAP.

Phosphorylation of the rRNA transcription factor upstream binding factor promotes its association with TATA binding protein

rRNA synthesis by RNA polymerase I requires both the promoter selectivity factor 1, which is composed of TATA binding protein (TBP) and three TBP-associated factors, and the activator upstream binding factor (UBF). Whereas there is strong evidence implicating a role for phosphorylation of UBF in the control of growth-induced increases in rRNA transcription, the mechanism of this effect is not known. Results of immunoprecipitation studies with TBP antibodies showed increased recovery of phosphorylated UBF from growth-stimulated smooth muscle cells. Moreover, using an immobilized protein-binding assay, we found that phosphorylation of UBF in vivo in response to stimulation with different growth factors or in vitro with smooth muscle cell nuclear extract increased its binding to TBP. Finally, we demonstrated that UBF–TBP binding depended on the C-terminal ‘acidic tail’ of UBF that was hyperphosphorylated at multiple serine sites after growth factor stimulation. Results of these studies suggest that phosphorylation of UBF and subsequent binding to TBP represent a key regulatory step in control of growth-induced increases in rRNA synthesis.

Dual role of the nuclear factor of activated T cells insert region in DNA recognition and cooperative contacts to activator protein 1

The transcription factors nuclear factor of activated T cells (NFAT) and activator protein 1 (AP-1) coordinately regulate cytokine gene expression in activated T-cells by binding to closely juxtaposed sites in cytokine promoters. The structural basis for cooperative binding of NFAT and AP-1 to these sites, and indeed for the cooperative binding of transcription factors to composite regulatory elements in general, is not well understood. Mutagenesis studies have identified a segment of AP-1, which lies at the junction of its DNA-binding and dimerization domains (basic region and leucine zipper, respectively), as being essential for protein–protein interactions with NFAT in the ternary NFAT/AP-1/DNA complex. In a model of the ternary complex, the segment of NFAT nearest AP-1 is the Rel insert region (RIR), a feature that is notable for its hypervariability in size and in sequence amongst members of the Rel transcription factor family. Here we have used mutational analysis to study the role of the NFAT RIR in binding to DNA and AP-1. Parallel yeast one-hybrid screening assays in combination with alanine-scanning mutagenesis led to the identification of four amino acid residues in the RIR of NFAT2 (also known as NFATC1 or NFATc) that are essential for cooperativity with AP-1 (Ile-544, Glu-545, Thr-551, and Ile-553), and three residues that are involved in interactions with DNA (Lys-538, Arg-540, and Asn-541). These results were confirmed and extended through in vitro binding assays. We thus conclude that the NFAT RIR plays an essential dual role in DNA recognition and cooperative binding to AP-1 family transcription factors.

RNA polymerase sigma factor determines start-site selection but is not required for upstream promoter element activation on heteroduplex (bubble) templates

Sequence-selective transcription by bacterial RNA polymerase (RNAP) requires σ factor that participates in both promoter recognition and DNA melting. RNAP lacking σ (core enzyme) will initiate RNA synthesis from duplex ends, nicks, gaps, and single-stranded regions. We have used DNA templates containing short regions of heteroduplex (bubbles) to compare initiation in the presence and absence of various σ factors. Using bubble templates containing the σD-dependent flagellin promoter, with or without its associated upstream promoter (UP) element, we demonstrate that UP element stimulation occurs efficiently even in the absence of σ. This supports a model in which the UP element acts primarily through the α subunit of core enzyme to increase the initial association of RNAP with the promoter. Core and holoenzyme do differ substantially in the template positions chosen for initiation: σD restricts initiation to sites 8–9 nucleotides downstream of the conserved −10 element. Remarkably, σA also has a dramatic effect on start-site selection even though the σA holoenzyme is inactive on the corresponding homoduplexes. The start sites chosen by the σA holoenzyme are located 8 nucleotides downstream of sequences on the nontemplate strand that resemble the conserved −10 hexamer recognized by σA. Thus, σA appears to recognize the −10 region even in a single-stranded state. We propose that in addition to its described roles in promoter recognition and start-site melting, σ also localizes the transcription start site.

Identification of a novel p53 functional domain that is necessary for efficient growth suppression

Activation of the p53 tumor suppressor protein has been demonstrated to block cell growth by inducing either a transient cell cycle arrest or programmed cell death (apoptosis). Although evidence exists linking p53’s function as an activator of transcription to its ability to effect cell cycle arrest, the role of this activity in the induction of apoptosis remains unclear. To gain insight into the molecular mechanisms underlying p53-mediated antiproliferative pathways, a study was initiated to explore the functions of a putative p53 signaling domain. This region of the human p53 protein is localized between amino acids 61 and 94 (out of 393) and is noteworthy in that it contains five repeats of the sequence PXXP (where P represents proline and X any amino acid). This motif has been shown to play a role in signal transduction via its SH3 domain binding activity. A p53 cDNA deletion mutant (ΔproAE), which lacks this entire proline-rich domain (deleted for amino acids 62–91), was created and characterized for a variety of p53 functions. The entire domain has been shown to be completely dispensable for transcriptional activation. On the other hand, this deletion of the p53 proline-rich domain impairs p53’s ability to suppress tumor cell growth in culture. Amino acid substitution mutations at residues 22 and 23 of p53 (eliminates transcriptional activity) also impair p53-mediated inhibition of cell growth in culture. Unlike wild-type p53, the ΔproAE mutant cDNA can be stably expressed in tumor derived cell lines with few immediate detrimental effects. These cells express physiologic levels of p53 protein that are induced normally in response to DNA damage, indicating that removal of the proline-rich domain does not disrupt p53’s upstream regulation by DNA damage. These data indicate that, in addition to the transcriptional activation domain, the p53 proline-rich domain plays a critical role in the transmission of antiproliferative signals downstream of the p53 protein and may link p53 to a direct signal transduction pathway.

Nutritional regulation of the fatty acid synthase promoter in vivo: Sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element

The transcription of fatty acid synthase (FAS), a central enzyme in de novo lipogenesis, is dramatically induced by fasting/refeeding and insulin. We reported that upstream stimulatory factor binding to the −65 E-box is required for induction of the FAS transcription by insulin in 3T3-L1 adipocytes. On the other hand, we recently found that two upstream 5′ regions are required for induction in vivo by fasting/refeeding and insulin; one at −278 to −131 albeit at a low level, and the other at −444 to −278 with an E-box at −332 where upstream stimulatory factor functions for maximal induction. Here, we generated double transgenic mice carrying the chloramphenicol acetyltransferase reporter driven by the various 5′ deletions of the FAS promoter region and a truncated active form of the sterol regulatory element (SRE) binding protein (SREBP)-1a. We found that SREBP participates in the nutritional regulation of the FAS promoter and that the region between −278 and −131 bp is required for SREBP function. We demonstrate that SREBP binds the −150 canonical SRE present between −278 and −131, and SREBP can function through the −150 SRE in cultured cells. These in vivo and in vitro results indicate that SREBP is involved in the nutritional induction of the FAS promoter via the −278/−131 region and that the −150 SRE is the target sequence.

PU.1 as an essential activator for the expression of gp91phox gene in human peripheral neutrophils, monocytes, and B lymphocytes

We have reported a deficiency of a 91-kDa glycoprotein component of the phagocyte NADPH oxidase (gp91phox) in neutrophils, monocytes, and B lymphocytes of a patient with X chromosome-linked chronic granulomatous disease. Sequence analysis of his gp91phox gene revealed a single-base mutation (C → T) at position −53. Electrophoresis mobility-shift assays showed that both PU.1 and hematopoietic-associated factor 1 (HAF-1) bound to the inverted PU.1 consensus sequence centered at position −53 of the gp91phox promoter, and the mutation at position −53 strongly inhibited the binding of both factors. It was also indicated that a mutation at position −50 strongly inhibited PU.1 binding but hardly inhibited HAF-1 binding, and a mutation at position −56 had an opposite binding specificity for these factors. In transient expression assay using HEL cells, which express PU.1 and HAF-1, the mutations at positions −53 and −50 significantly reduced the gp91phox promoter activity; however, the mutation at position −56 did not affect the promoter activity. In transient cotransfection study, PU.1 dramatically activated the gp91phox promoter in Jurkat T cells, which originally contained HAF-1 but not PU.1. In addition, the single-base mutation (C → T) at position −52 that was identified in a patient with chronic granulomatous disease inhibited the binding of PU.1 to the promoter. We therefore conclude that PU.1 is an essential activator for the expression of gp91phox gene in human neutrophils, monocytes, and B lymphocytes.

Posttranscriptional regulation of urokinase plasminogen activator receptor messenger RNA levels by leukocyte integrin engagement

As an adhesion receptor, the β2 integrin lymphocyte function-associated antigen-1 (LFA-1) contributes a strong adhesive force to promote T lymphocyte recirculation and interaction with antigen-presenting cells. As a signaling molecule, LFA-1-mediates transmembrane signaling, which leads to the generation of second messengers and costimulation resulting in T cell activation. We recently have demonstrated that, in costimulatory fashion, LFA-1 activation promotes the induction of T cell membrane urokinase plasminogen activator receptor (uPAR) and that this induced uPAR is functional. To investigate the mechanism(s) of this induction, we used the RNA polymerase II inhibitor 5,6-dichloro-1-β-d-ribobenzimidazole and determined that uPAR mRNA degradation is delayed by LFA-1 activation. Cloning of the wild-type, deleted and mutated 3′-untranslated region of the uPAR cDNA into a serum-inducible rabbit β-globin cDNA reporter construct revealed that the AU-rich elements and, in particular the nonameric UUAUUUAUU sequence, are crucial cis-acting elements in uPAR mRNA degradation. Experiments in which Jurkat T cells were transfected with reporter constructs demonstrated that LFA-1 engagement was able to stabilize the unstable reporter mRNA containing the uPAR 3′-untranslated region. Our study reveals a consequence of adhesion receptor-mediated signaling in T cells, which is potentially important in the regulation of T cell activation, including production of cytokines and expression of proto-oncogenes, many of which are controlled through 3′ AU-rich elements.

A novel DNA-binding motif in MarA: The first structure for an AraC family transcriptional activator

A crystal structure for a member of the AraC prokaryotic transcriptional activator family, MarA, in complex with its cognate DNA-binding site is described. MarA consists of two similar subdomains, each containing a helix–turn–helix DNA-binding motif. The two recognition helices of the motifs are inserted into adjacent major groove segments on the same face of the DNA but are separated by only 27 Å thereby bending the DNA by ≈35°. Extensive interactions between the recognition helices and the DNA major groove provide the sequence specificity.