984 resultados para protein X-ray diffraction


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

[Cu2(μO2CCH3)4(H2O)2], [CuCO3·Cu(OH)2], [CoSO4·7H2O], [Co((+)-tartrate)], and [FeSO4·7H2O] react with excess racemic (±)- 1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-PhosH} to give mononuclear CuII, CoII and FeII products. The cobalt product, [Co(CH3OH)4(H2O)2]((+)-Phos)((−)-Phos) ·2CH3OH·H2O (7), has been identified by X-ray diffraction. The high-spin, octahedral CoII atom is ligated by four equatorial methanol molecules and two axial water molecules. A (+)- and a (−)-Phos− ion are associated with each molecule of the complex but are not coordinated to the metal centre. For the other CoII, CuII and FeII samples of similar formulation to (7) it is also thought that the Phos− ions are not bonded directly to the metal. When some of the CuII and CoII samples are heated under high vacuum there is evidence that the Phos− ions are coordinated directly to the metals in the products.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The X-ray diffraction pattern of glassy poly(2-hydroxypropyl ether of bisphenol A) is studied at room temperature on oriented samples in order to associate its different peaks to different structural correlations. On the other hand, X-ray diffraction patterns have been obtained at different temperatures from Tg − 50 K up to Tg + 50 K for the above-mentioned polymer. Attention has been paid to the evolution with temperature of the position of the wide diffraction maximum corresponding to interchain correlations in the polymer. The temperature evolution of this parameter shows a marked discontinuity just at the glass transition temperature.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

High-resolution X-ray diffractometry is used to probe the nature of a diffraction-peak broadening previously noticed in quantum dots (QDs) systems with freestanding InAs islands on top of GaAs (001) substrates [Freitas et al., Phys. Status Solidi (A) 204, 2548 (2007)]. The procedure is hence extended to further investigate the capping process of InAs/GaAs QDs. A direct correlation is established between QDs growth rates and misorientation of lattice-planes at the samples surfaces. This effect provides an alternative too] for studying average strain fields on QDs systems in standard triple axis diffractometers running on X-ray tube sources, which are much more common than synchrotron facilities. (C) 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this work we use magnetic resonant x-ray diffraction to study the magnetic properties of a 1.5 mu m EuTe film and an EuTe/PbTe superlattice (SL). The samples were grown by molecular beam epitaxy on (111) oriented BaF(2) substrates. The measurements were made at the Eu L(2) absorption edge, taking profit of the resonant enhancement of more than two orders in the magnetically diffracted intensity. At resonance, high counting rates above 11000 cps were obtained for the 1.5 gm EuTe film, allowing to check for the type II antiferromagnetic order of EuTe. An equal population of the three possible in-plane magnetic domains was found. The EuTe/PbTe SL magnetic peak showed a satellite structure, indicating the presence of magnetic correlations among the 5 ML (monolayers) EuTe layers across the 15 ML PbTe non-magnetic spacers. The temperature dependence of the integrated intensities of the film and the SL yielded different Neel temperatures T(N). The lower T(N) for the SL is explained considering the higher influence of the surface atoms, with partial bonds lost.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The temperature dependence of the crystalline structure and the lattice parameters of Pb1-xLaxZr0.40Ti0.60O3 ferroelectric ceramic system with 0.00 x 0.21 was determined. The samples with x 0.11 show a cubic-to-tetragonal phase transition at the maximum dielectric permittivity, Tmax. Above this amount and especially for the x = 0.12 sample, a spontaneous phase transition from a relaxor ferroelectric state (cubic phase) to a ferroelectric state (tetragonal phase) is observed upon cooling below the Tmax. Unlike what has been reported in other studies, the x = 0.13, 0.14, and 0.15 samples, which present a more pronounced relaxor behavior, also presents a spontaneous normal-to-relaxor transition, indicated by a cubic to tetragonal symmetry below the Tmax. The origin of this anomaly has been associated with an increase in the degree of tetragonality, confirmed by the measurements of the X-ray diffraction patterns. The differential thermal analysis (DSC) measurements also confirm the existence of these phase transitions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis, structural characterization, voltammetric experiments and antibacterial activity of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] were studied and compared with similar previously reported copper complexes. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O crystallized in a monoclinic system, space group C2/c where the nickel ion was in a slightly distorted octahedral environment, coordinated with two sulfisoxazole molecules through the heterocyclic nitrogen and four water molecules. [Ni(sulfapyridine)(2)] crystallized in a orthorhombic crystal system, space group Pnab. The nickel ion was in a distorted octahedral environment, coordinated by two aryl amine N from two sulfonamides acting as monodentate ligands and four N atoms (two sulfonamidic N and two heterocyclic N) from two different sulfonamide molecules acting as bidentate ligands. Differential pulse voltammograms were recorded showing irreversible peaks at 1040 and 1070 mV, respectively, attributed to Ni(II)/Ni(III) process. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] presented different antibacterial behavior against Staphylococcus aureus and Escherichia coli from the similar copper complexes and they were inactive against Mycobacterium tuberculosis. (c) 2007 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Structural and conformational properties of 1H-Isoindole-1,3(2H)-dione, 2-[(methoxycarbonyl)thio] (S-phthalimido O-methyl thiocarbonate) are analyzed using a combined approach including X-ray diffraction, vibrational spectra and theoretical calculation methods. The vibrational properties have been studied by infrared and Raman spectroscopies along with quantum chemical calculations (B3LYP and B3PW91 functional in connection with the 6-311++G** and aug-cc-pVDZ basis sets). The crystal structure was determined by X-ray diffraction methods. The substance crystallizes in the monoclinic P2(1)/c space group with a = 6.795(1), b = 5.109(1), c = 30.011(3) angstrom, beta = 90.310(3)degrees and Z = 4 molecules per unit cell. The conformation adopted by the N-S-C=O group is syn (C=O double bond in synperiplanar orientation with respect to the N-S single bond). The experimental molecular structure is well reproduced by the MP2/aug-cc-pVDZ method. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A robust, direct, rapid and non-destructive X-ray diffraction crystallography method to detect the polyprenylated benzophenones 7-epi-clusianone (1) and guttiferone A (2) in extracts from Garcinia brasiliensis is presented. Powder samples of benzophenones 1 and 2, dried hexane extracts from G. brasiliensis seeds and fruit`s pericarp, and the dried ethanolic extract from G. brasiliensis seeds were unambiguously characterized by powder X-ray diffractometry. The calculated X-ray diffraction peaks from crystal structures of analytes 1 and 2, previously determined by single-crystal X-ray diffraction technique, were overlaid to those of the experimental powder diffractograms, providing a practical identification of these compounds in the analyzed material and confirming the pure contents of the powder samples. Using the X-ray diffraction crystallography method, the studied polyprenylated benzophenones were selectively and simultaneously detected in the extracts which were mounted directly on sample holder. In addition, reference materials of the analytes were not required for analyses since the crystal structures of the compounds are known. High performance liquid chromatography analyses also were comparatively carried out to quantify the analytes in the same plant extracts showing to be in agreement with X-ray diffraction crystallography method. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Importin-alpha is the nuclear import receptor that recognizes cargo proteins with nuclear localization sequences (NLSs). Tile study of NLS peptidomimetics can provide a better understanding of the requirements for the molecular recognition of cargo proteins by importin-alpha, and potentially engender a large number of applications in medicine. Importin-a was crystallized with a set of six NLS peptidomimetics, and X-ray diffraction data were collected in the range 2.1-2.5 angstrom resolution. Preliminary electron density calculations show that the ligands are present in the crystals. (c) 2005 Elsevier B.V All rights reserved.