134 resultados para interleukins
Resumo:
Shock and resuscitation render patients more susceptible to acute lung injury due to an exacerbated immune response to subsequent inflammatory stimuli. To study the role of innate immunity in this situation, we investigated acute lung injury in an experimental model of ischemia-reperfusion (I-R) followed by an early challenge with live bacteria. Conscious rats (N = 8 in each group) were submitted to controlled hemorrhage and resuscitated with isotonic saline (SS, 0.9% NaCl) or hypertonic saline (HS, 7.5% NaCl) solution, followed by intratracheal or intraperitoneal inoculation of Escherichia coli. After infection, toll-like receptor (TLR) 2 and 4 mRNA expression was monitored by RT-PCR in infected tissues. Plasma levels of tumor necrosis factor α and interleukins 6 and 10 were determined by ELISA. All animals showed similar hemodynamic variables, with mean arterial pressure decreasing to nearly 40 mmHg after bleeding. HS or SS used as resuscitation fluid yielded equal hemodynamic results. Intratracheal E. coli inoculation per se induced a marked neutrophil infiltration in septa and inside the alveoli, while intraperitoneal inoculation-associated neutrophils and edema were restricted to the interseptal space. Previous I-R enhanced lung neutrophil infiltration upon bacterial challenge when SS was used as reperfusion fluid, whereas neutrophil influx was unchanged in HS-treated animals. No difference in TLR expression or cytokine secretion was detected between groups receiving HS or SS. We conclude that HS is effective in reducing the early inflammatory response to infection after I-R, and that this phenomenon is achieved by modulation of factors other than expression of innate immunity components.
Resumo:
It is well known that the risk of development of gastric cancer (GC) in Helicobacter pylori-infected patients depends on several factors. Thus, the aim of this study was to investigate the effect of proinflammatory cytokine gene polymorphisms for IL-1β, IL-1RN and TNF-α on the development of GC in a Brazilian population. A total of 202 biopsies obtained from Brazilian patients with chronic gastritis and GC were included in the study. Infection with H. pylori cagA+ was determined by the polymerase chain reaction (PCR) as previously described. IL-1β, IL-1RN and TNF-α polymorphism genotyping was performed by restriction fragment length polymorphism PCR. Associations between gene polymorphisms, clinical diseases and virulence markers were evaluated using either the χ² test or the Fisher exact test. Our results demonstrated that the IL-1β -511 C/C and IL-1β -511 C/T alleles were associated with chronic gastritis in H. pylori-positive patients (P = 0.04 and P = 0.05, respectively) and the IL-1β -511 C/C genotype was associated with GC (P = 0.03). The frequency of IL-1RN alleles from patients with chronic gastritis and GC indicated that there was no difference between the genotypes of the groups studied. Similar results were found for TNF-α -308 gene polymorphisms. Our results indicate that the IL-1β -511 C/C and C/T gene polymorphisms are associated with chronic gastritis and GC development in H. pylori-infected individuals.
Resumo:
Deep venous thrombosis (DVT) is a common surgical complication in cancer patients and evidence that inflammation plays a role in the occurrence of DVT is increasing. We studied a population of cancer patients with abdominal malignancies with the aim of investigating whether the levels of circulating inflammatory cytokines were associated with postoperative DVT, and to determine the levels in DVT diagnoses. The serum levels of C-reactive protein (CRP), interleukins (IL)-6 and IL-10, nuclear transcription factor-κB (NF-κB) and E-selectin (E-Sel) were determined in 120 individuals, who were divided into 3 groups: healthy controls, patients with and patients without DVT after surgery for an abdominal malignancy. Data were analyzed by ANOVA, Dunnet's T3 test, chi-square test, and univariate and multivariate logistic regression as needed. The CRP, IL-6, NF-κB, and E-Sel levels in patients with DVT were significantly higher than those in the other groups (P<0.05). The IL-10 level was higher in patients with DVT than in controls but lower than in patients without DVT. Univariate analysis revealed that CRP, IL-6, NF-κB, and E-Sel were statistically associated with the risk of DVT (OR=1.98, P=0.002; OR=1.17, P=0.000; OR=1.03, P=0.042; and OR=1.38, P=0.003; respectively), whereas IL-10 had a protective effect (OR=0.94, P=0.011). Multivariate analysis showed that E-Sel was an independent risk factor (OR=1.41, P=0.000). Thus, this study indicated that an increased serum level of E-Sel was associated with increased DVT risk in postoperative patients with abdominal malignancy, indicating that E-Sel may be a useful predictor of diagnosis of DVT.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
La sclérose systémique (ScS) est une maladie auto-immune dont l’un des principaux auto-anticorps, dirigé contre la protéine centromérique B (CENP-B), est fortement associé à l’hypertension artérielle pulmonaire, l’une des causes majeures de décès dû à la ScS. L’hypertension résulte de l’occlusion progressive des vaisseaux suite à une hyperactivation des cellules musculaires lisses (CML) de la paroi vasculaire. Cependant, les facteurs responsables de ce remodelage vasculaire restent inconnus. Plusieurs études récentes ont démontré que certains auto-antigènes possèdent des fonctions biologiques additionnelles lorsqu'ils se retrouvent dans le milieu extracellulaire. En effet, une fois libérés par nécrose ou apoptose, ces auto-antigènes adoptent une activité biologique qui s'apparente à celles des cytokines et peuvent ainsi participer aux processus normaux de réparation de blessure et/ou acquérir une activité pathogène qui contribue au développement de certaines maladies auto-immunes. Nos résultats suggèrent que la CENP-B peut être ajoutée à cette liste de molécules bifonctionnelles. À l'aide des techniques d'immunofluorescence, d'ELISA cellulaire et de cytométrie en flux, nous avons démontré que la CENP-B se liait spécifiquement à la surface des CML vasculaire de l’artère pulmonaire avec une plus grande affinité pour le phénotype contractile que synthétique. Cette liaison provoquait la migration des cellules ainsi que la sécrétion de cytokines pro-inflammatoires telles que l’interleukine 6 et 8. Les mécanismes par lesquels la protéine exerçait ces effets impliquaient la phosphorylation de FAK et Src ainsi que la voie des MAP kinases, avec ERK1/2 et p38. Des études de signalisation intracellulaire effectuées à l’aide de plusieurs inhibiteurs spécifiques ainsi que des études de désensibilisation nous ont permis d’identifier le récepteur de la CENP-B en plus d’identifier les mécanismes complets de sa signalisation membranaire. Nous avons démontré que la CENP-B se liait de manière spécifique aux CML vasculaire via le récepteur de chémokine 3 (CCR3) pour ensuite transactiver le récepteur EGF, selon un mécanisme métalloprotéase-dépendant qui implique le relargage du HB-EGF. Cette transactivation est un processus important dans l’activation de la voie des MAP kinases ainsi que dans la sécrétion d’IL-8 induite par la CENP-B. Finalement, nous avons démontré que les auto-anticorps anti-CENP-B pouvaient abolir cette cascade de signalisation, empêchant ainsi la CENP-B d’exercer son rôle de cytokine. L’identification de la CENP-B comme ligand du CCR3 ouvre donc plusieurs perspectives quant à l’étude du rôle pathogène des auto-anticorps anti-CENP-B dans la ScS.
Resumo:
L’immunosuppression optimale après greffe d’organe solide est une balance délicate et propre à chaque individu entre le risque de rejet et les risques liés à une surexposition au traitement immunosuppresseur. L’évaluation de la fonction résiduelle des lymphocytes T après stimulation par un mitogène (pharmacodynamie effective) devrait permettre de mesurer l’effet direct des médicaments immunosuppresseurs sur leur cible. Nous avons étudié différents paramètres de pharmacodynamie effective chez 34 receveurs pédiatriques de greffe d’organes solides traités par tacrolimus et mycophénolate. Les tests proposés dans ce travail sont adaptés au milieu pédiatrique et à une réalisation en temps réel. La quantification du CD25 parmi les CD4 activés par l’OKT3 permet de distinguer deux groupes de patients selon leur degré d’immunosuppression. L’âge médian est plus bas et la concentration plasmatique médiane en MPA plus élevée dans le groupe de patients plus fortement immunosupprimés. L’étude des paramètres immunologiques pouvant influencer la réponse (sécrétion des interleukines, proportion des sous-populations lymphocytaires CD4, CD8, T naïfs et Trég) ainsi que l’étude du pouvoir de restauration de la fonction lymphocytaire par l’Il-2, la guanosine ou la xanthosine, ne permettent pas de mieux comprendre les variabilités interindividuelles observées. Ces résultats devront être confirmés sur une cohorte plus grande de patients afin de juger de leur intérêt en pratique clinique.
Resumo:
Background: Swine influenza is a highly contagious viral infection in pigs affecting the respiratory tract that can have significant economic impacts. Streptococcus suis serotype 2 is one of the most important post-weaning bacterial pathogens in swine causing different infections, including pneumonia. Both pathogens are important contributors to the porcine respiratory disease complex. Outbreaks of swine influenza virus with a significant level of co-infections due to S. suis have lately been reported. In order to analyze, for the first time, the transcriptional host response of swine tracheal epithelial (NPTr) cells to H1N1 swine influenza virus (swH1N1) infection, S. suis serotype 2 infection and a dual infection, we carried out a comprehensive gene expression profiling using a microarray approach. Results: Gene clustering showed that the swH1N1 and swH1N1/S. suis infections modified the expression of genes in a similar manner. Additionally, infection of NPTr cells by S. suis alone resulted in fewer differentially expressed genes compared to mock-infected cells. However, some important genes coding for inflammatory mediators such as chemokines, interleukins, cell adhesion molecules, and eicosanoids were significantly upregulated in the presence of both pathogens compared to infection with each pathogen individually. This synergy may be the consequence, at least in part, of an increased bacterial adhesion/invasion of epithelial cells previously infected by swH1N1, as recently reported. Conclusion: Influenza virus would replicate in the respiratory epithelium and induce an inflammatory infiltrate comprised of mononuclear cells and neutrophils. In a co-infection situation, although these cells would be unable to phagocyte and kill S. suis, they are highly activated by this pathogen. S. suis is not considered a primary pulmonary pathogen, but an exacerbated production of proinflammatory mediators during a co-infection with influenza virus may be important in the pathogenesis and clinical outcome of S. suis-induced respiratory diseases.
Resumo:
Objetivo: presentar el estado del arte de las investigaciones que, hasta el momento, relacionan el polimorfismo genético del paciente con la evolución de la sepsis, como herramienta diagnóstica y un nuevo enfoque terapéutico de esta condición. Los conceptos actuales basados en investigaciones sostienen que el polimorfismo genético del individuo es relevante en la evolución de la enfermedad y en la respuesta efectiva al tratamiento del paciente en estado crítico, en especial con sepsis bacteriana y choque séptico. Materiales y métodos: se revisó literatura indexada que relaciona los factores genéticos con la evolución de algunas enfermedades del paciente en estado crítico. Resultados: las características particulares de la enfermedad estarían influenciadas por el acervo genético del paciente, condicionando en gran medida la respuesta patofisiológica. Se ha evidenciado la susceptibilidad genética de algunos individuos a desarrollar infección; estos individuos con un tratamiento similar no evolucionan de igual forma, desencadenándose una sepsis bacteriana grave y choque séptico. El polimorfismo en los genes que codifican por el factor de necrosis tumoral -α (TNF-α) las interlucinas- 1 (IL-1), IL-6, IL-10, el factor soluble CD-14, los receptores similares a Toll y el inhibidor tipo 1 del activador del plasminógeno estaría asociado con el desarrollo de sepsis grave y choque séptico, en particular las mutaciones TNF-α 308 G/A, PAI-1 4G/4G, IL-6 174 G/C. Conclusiones: el conocimiento de la susceptibilidad genética, los factores de riesgo y el buen funcionamiento del sistema inmune de cada persona ayudan a reducir y compensar las complicaciones de la sepsis bacteriana. Es claro que el tratamiento oportuno individualizado en los pacientes con sepsis se asocia con disminución de la mortalidad y con reducción en el deterioro de la respuesta inflamatoria.
Resumo:
Immunodiagnostic microneedles provide a novel way to extract protein biomarkers from the skin in a minimally invasive manner for analysis in vitro. The technology could overcome challenges in biomarker analysis specifically in solid tissue, which currently often involves invasive biopsies. This study describes the development of a multiplex immunodiagnostic device incorporating mechanisms to detect multiple antigens simultaneously, as well as internal assay controls for result validation. A novel detection method is also proposed. It enables signal detection specifically at microneedle tips and therefore may aid the construction of depth profiles of skin biomarkers. The detection method can be coupled with computerised densitometry for signal quantitation. The antigen specificity, sensitivity and functional stability of the device were assessed against a number of model biomarkers. Detection and analysis of endogenous antigens (interleukins 1α and 6) from the skin using the device was demonstrated. The results were verified using conventional enzyme-linked immunosorbent assays. The detection limit of the microneedle device, at ≤10 pg/mL, was at least comparable to conventional plate-based solid-phase enzyme immunoassays.
Resumo:
Glutamine is the most important donor of NH(3) in kidney playing an important role in acid-base buffering system. Besides this effect, glutamine presents many other relevant functions in the whole body, such as a precursor of arginine in adult and neonates. In addition to these effects, some studies have shown that glutamine can potentiate renal disease. In the present study, the effect of short-term treatment (15 days) with glutamine on control and diabetic rats was investigated. Using biochemical, histological and molecular biology analysis from control and diabetic rats we verified that glutamine supplementation increase in pro-inflammatory interleukins (IL)-1 beta and IL-6 content in renal cortex and induce alteration in glomerular characteristics. This study showed that short-term treatment with glutamine in association with increased glucose levels could cause important alterations in glomerular morphology that may result in fast progression of kidney failure.
Resumo:
Background/Aims: Prolonged physical exercise induces adaptive alterations in the hypothalamic-pituitary axis, increasing cortisol metabolism, and reducing cortisol synthesis and glucocorticoid sensitivity. The mechanisms responsible for this relative glucocorticoid resistance remain unknown but may involve expression of genes encoding glucocorticoid receptor (GR) and/or inflammatory molecules of nuclear factor kappa B1 (NFkB1) signaling pathway and cytokines. This study aimed to determine the impact of prolonged physical training on the expression of genes involved in glucocorticoid action and inflammatory response. Methods: Normal sedentary male cadets of the Brazilian Air Force Academy were submitted to 6 weeks of standardized physical training. Eighteen of 29 initially selected cadets were able to fully complete the training program. Fasting glucose, insulin and cortisol levels, cytokine concentration and the expression of genes encoding GR, NFkB1, inhibitor of NFkB1 and IkB kinase A were determined before and after the training period. Results: Prolonged physical exercise reduced the basal cortisol levels and the percent cortisol reduction after dexamethasone. These findings were associated with a significant reduction in the mRNA levels of GR (6.3%), NFkB1 (63%), inhibitor of NFkB1 (25%) and IkB kinase A (46%) with concomitant reduction in cytokine concentrations (ELISA). Conclusions: Prolonged physical training decreases the glucocorticoid sensitivity and the mRNA levels of the GR gene combined with decreased mRNA of genes related to the NFkB pathway. Copyright (C) 2010 S. Karger AG, Basel
Resumo:
Interleukin-22 (IL-22) is a member of the interleukin-10 cytokine family, which is involved in anti-microbial defenses, tissue damage protection and repair, and acute phase responses. Its signaling mechanism involves the sequential binding of IL-22 to interleukin-22 receptor 1 (IL-22R1), and of this dimer to interleukin-10 receptor 2 (IL-10R2) extracellular domain. We report a 1.9 A crystal structure of the IL-22/IL-22R1 complex, revealing crucial interacting residues at the IL-22/IL-22R1 interface. Functional importance of key residues was confirmed by site-directed mutagenesis and functional studies. Based on the X-ray structure of the binary complex, we discuss a molecular basis of the IL-22/IL-22R1 recognition by IL-10R2.
Resumo:
In 1956, Africanized bees began to spread in the American continent from southern Brazil, where original African bees mated with European bees. A few years later, in 1990, these Africanized bees reached the United States and were found in Texas. Currently, these hybrid bees are found in several North American states and will probably reach the Canadian border in the future. Although the presence of Africanized bees had produced positive effects on Brazilian economy, including improvement in crop pollination and in honey production, turning Brazil into a major exporter, the negative impacts-such as swarming, aggressive behavior, and the ability to mass attack-resulted in serious and fatal envenomation with humans and animals. Victims of bee attacks usually develop a severe envenomation syndrome characterized by the release of a large amount of cytokines [interleukins (IL) IL-1, IL-6, IL-8], and tumor necrosis factor (TNF). Subsequently, such cytokines produce an acute inflammatory response that triggers adverse effects on skeletal muscles; bone marrow; hepatic and renal functions; and cardiovascular, central nervous, and immune systems. Finally, the aim of the present review is to study historical characteristics and current status of Africanized bees' spread, the composition of their venom, the impact of the bees on the Brazilian economy and ecology, and clinical aspects of their stings including immune response, and to suggest a protocol for bee sting management since there is no safe and effective antivenom available.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)