985 resultados para fragile states
Resumo:
We employ comprehensive linked employer-employee data for Brazil to analyze wage determinants and compare results to Abowd et al. (2001) for French and U.S. manufacturing. While returns to human capita in Brazilian manufacturing exceed those of the other countries, occupation and gender differentials are similar. The worker-characteristics component accounts for much of the greater wage inequality in Brazil, but the establishment-fixed component has scant explanatory power. Thus, firm-or industry-level factors offer little scope for explaining the differences in wage inequality. Brazil`s wage structure resembles that of France, a country with some similarity in labor market institutions.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Serotonin (5-HT) plays a key role in the neural circuitry mediating unconditioned and conditioned fear responses related to panic and generalized anxiety disorders. The basolateral nucleus of the amygdala (BLA) and the dorsal periaqueductal gray (dPAG) appear to be mainly involved in these conditions. The aim of this study was to measure the extracellular level of 5-HT and its metabolite 5-hydroxyindolacetic acid (5-HIAA) in the BLA and dPAG during unconditioned and conditioned fear states using in vivo microdialysis procedure. Thus, for the unconditioned fear test, animals were chemically stimulated in the dPAG with semicarbazide, an inhibitor of the gamma-aminobutyric acid-synthesizing enzyme glutamic acid decarboxylase. For the conditioned fear test, animals were subjected to a contextual conditioned fear paradigm using electrical footshock as the unconditioned stimulus. The results show that the 5-HT and 5-HIAA level in the BLA and dPAG did not change during unconditioned fear, whereas 5-HT concentration, but not 5-HIAA concentration, increased in these brain areas during conditioned fear. The present study showed that the 5-HT system was activated during conditioned fear, whereas it remained unchanged during unconditioned fear, supporting the hypothesis that 5-HT has distinct roles in conditioned and unconditioned fear (dual role of 5-HT in anxiety disorders). (C) 2009 Elsevier B.V. All rights reserved.
The states, diffusion, and concentration distribution of water in radiation-formed PVA/PVP hydrogels
Resumo:
Hydrogels with various compositions of polyvinyl alcohol (PVA) and poly(1-vinyl-2-pyrrolidinone) (PVP) were prepared by irradiating mixtures of PVA and PVP in aqueous solutions with gamma-rays from Co-60 sources at room temperature. The states of water in the hydrogels were characterized using DSC and NMR T-2 relaxation measurements and the kinetics of water diffusion in the hydrogels were studied by sorption experiments and NMR imaging. The DSC endothermic peaks in the temperature range -10 to +10 degrees C implied that there are at least two kinds of freezable water present in the matrix. The difference between the total water content and the freezable water content was refer-red to as bound water, which is not freezable. The weight fraction of water at which only nonfreezable water is present in a hydrogel with F-VP = 0.19 has been estimated to be g(H2O)/g(Polymer) = 0.375. From water sorption experiments, it was demonstrated that the early stage of the diffusion of water into the hydrogels was Fickian. A curve-fit of the early-stage experimental data to the Fickian model allowed determination of the water diffusion coefficient, which was found to lie between 1.5 x 10(-11) m(2) s(-1) and 4.5 x 10(-11) m(2) s(-1), depending on the polymer composition, the cross-link density, and the temperature. It was also found that the energy barrier for diffusion of water molecules into PVA/PVP hydrogels was approximate to 24 kJ mol(-1). Additionally, the diffusion coefficients determined from NMR imaging of the volumetric swelling of the gels agreed well with the results obtained by the mass sorption method.
Resumo:
We theoretically study the Hilbert space structure of two neighboring P-donor electrons in silicon-based quantum computer architectures. To use electron spins as qubits, a crucial condition is the isolation of the electron spins from their environment, including the electronic orbital degrees of freedom. We provide detailed electronic structure calculations of both the single donor electron wave function and the two-electron pair wave function. We adopted a molecular orbital method for the two-electron problem, forming a basis with the calculated single donor electron orbitals. Our two-electron basis contains many singlet and triplet orbital excited states, in addition to the two simple ground state singlet and triplet orbitals usually used in the Heitler-London approximation to describe the two-electron donor pair wave function. We determined the excitation spectrum of the two-donor system, and study its dependence on strain, lattice position, and interdonor separation. This allows us to determine how isolated the ground state singlet and triplet orbitals are from the rest of the excited state Hilbert space. In addition to calculating the energy spectrum, we are also able to evaluate the exchange coupling between the two donor electrons, and the double occupancy probability that both electrons will reside on the same P donor. These two quantities are very important for logical operations in solid-state quantum computing devices, as a large exchange coupling achieves faster gating times, while the magnitude of the double occupancy probability can affect the error rate.
Resumo:
Objective: The aim of this study was to examine the hypothesis that non-purge-related binge-eating in obesity is maintained by a 'trade-off' in which a highly aversive emotional state is exchanged for a less aversive state. Method: Ninety-eight obese binge-eaters meeting the DSM-IV criteria for binge-eating disorder [1] were contrasted with 65 non-binge-eating controls on their perceived distress associated with negative mood states usually experienced before and after binges. Results: Binge-eaters reported significantly greater distress and lower tolerance of negative mood compared to controls. Furthermore, when compared with controls, binge-eaters reported that emotions typically reported before binges (e.g. anger) were more aversive than those reported after (e.g. guilt). Conclusions: These results were interpreted as supporting the 'trade-off' theory and have implications for the treatment of binge-eating disorder.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Elite athletes repeatedly completed the Profile of Mood States (POMS) during a six month training season to determine whether athletes who are stale show different values from those who are intensely trained but not stale. Nineteen elite male and female swimmers were studied at five time points: three times during training (early-, mid-, and late-season), during tapering prior to, and then shortly after, major competition. Of the 14 subjects who completed the entire monitoring program, three were classified as stale based on several criteria including poorer performance and prolonged high level of fatigue. Two of the stale swimmers showed higher scores for several of the POMS measures throughout the season compared with the remainder who were classified as non-stale. However, the third stale swimmer showed similar scores to those of the non-stale swimmers. Several POMS measures were significantly correlated with training intensity but not with training volume. It was concluded that stale athletes may not always demonstrate different mood scores from non-stale athletes but that the total mood disturbance score (TMD) as evaluated by the POMS may be used to indicate those athletes predisposed to the condition long before the symptoms of poor performance and prolonged fatigue are observed. TMD scores were chosen to monitor staleness since they represent a synthesis of the six specific mood states measured by the POMS.
Resumo:
Mycosis fungoides (MF) and Sezary syndrome (SS), the major forms of cutaneous T-cell lymphoma, have unique characteristics that distinguish them from other types of non-Hodgkin`s lymphomas. Clinical trials in MF/SS have suffered from a lack of standardization in evaluation, staging, assessment, end points, and response criteria. Recently defined criteria for the diagnosis of early MF, guidelines for initial evaluation, and revised staging and classification criteria for MF and SS now offer the potential for uniform staging of patients enrolled in clinical trials for MF/SS. This article presents consensus recommendations for the general conduct of clinical trials of patients with MF/SS as well as methods for standardized assessment of potential disease manifestations in skin, lymph nodes, blood, and visceral organs, and definition of end points and response criteria. These guidelines should facilitate collaboration among investigators and collation of data from sponsor-generated or investigator-initiated clinical trials involving patients with MF or SS. J Clin Oncol 29:2598-2607. (C) 2011 by American Society of Clinical Oncology
Resumo:
A feedback model based on direct photodetection and micromaser-like atomic injection is proposed for the preservation of quantum coherence in a cavity. We show that in this way it is possible to slow down significantly the decoherence of Schrodinger cat states.